TFIID is a transcription factor complex that is required for RNAPII-mediated transcription of protein-coding genes and some small nuclear RNAs (reviewed in 4). The complex is composed of Spt15p (TATA binding protein; TBP) and 14 TBP-associated factors (TAFs): Taf1p, Taf2p, Taf3p, Taf4p, Taf5p, Taf6p, Taf7p, Taf8p, Taf9p, Taf10p, Taf11p, Taf12p, Taf13p, Taf14p (7, 10). The TFIID complex is required for basal transcription, but some individual subunits regulate the activated transcription of a subset of genes (13, 16, 17, 18, 19).Recognition of promoter DNA by the TFIID complex is required for the formation of the preinitiation complex (PIC) during transcription initiation (3, 6). The interaction between the TFIID complex and the promoter is stabilized by TFIIA (6, 11). The recruitment of TFIID to promoters is dependent on an upstream activating sequence in the promoter region (14). A subset of the TAFs (Taf5p, Taf6p, Taf9p, Taf10p, and Taf12p) are subunits of both TFIID and the the Spt-Ada-Gcn5-acetyltransferase (SAGA) transcriptional regulatory complex, which functions in nucleosomal histone acetylation and chromatin-associated transcriptional activation or repression (5, 8, 9). The results of genome-wide studies indicate that TFIID functions primarily at the TATA-less promoters of stress-repressed housekeeping genes, representing about 90% of the yeast genome, while SAGA predominates at highly-regulated, stress-responsive TATA box-containing genes, representing about 10% of the genome (12, 15).", "date_edited": "2009-10-02"}, "literature_overview": {"primary_count": 22, "additional_count": 38, "review_count": 30, "go_count": 5, "phenotype_count": 2, "disease_count": 0, "interaction_count": 51, "regulation_count": 4, "ptm_count": 9, "funComplement_count": 0, "htp_count": 8, "total_count": 141}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "genetic_position": 31.0, "regulation_overview": {"regulator_count": 3, "target_count": 0}, "reference_mapping": {"556641": 1, "549611": 2, "550252": 3, "593632": 4, "622591": 5, "470615": 6, "560352": 7, "555555": 8, "542570": 9, "536779": 10, "608643": 11, "545213": 12, "585367": 13, "554485": 14, "467934": 15, "616059": 16, "553618": 17, "609871": 18, "601509": 19, "627302": 20}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: TAF150", "date_created": "2010-02-16", "references": []}, {"category": "Name", "history_type": "LSP", "note": "Name: TAF2", "date_created": "2000-05-19", "references": [{"id": 556641, "display_name": "Tora L (2002)", "citation": "Tora L (2002) A unified nomenclature for TATA box binding protein (TBP)-associated factors (TAFs) involved in RNA polymerase II transcription. Genes Dev 16(6):673-5", "pubmed_id": 11963920, "link": "/reference/S000071622", "year": 2002, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gad.976402"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11963920"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: TafII150", "date_created": "2010-02-16", "references": []}, {"category": "Name", "history_type": "LSP", "note": "Name: TSM1", "date_created": "2010-02-16", "references": [{"id": 627302, "display_name": "Ray BL, et al. (1991)", "citation": "Ray BL, et al. (1991) The TSM1 gene of Saccharomyces cerevisiae overlaps the MAT locus. Curr Genet 20(1-2):25-31", "pubmed_id": 1840512, "link": "/reference/S000046664", "year": 1991, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00312761"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1840512"}]}]}, {"category": "Nomenclature history", "history_type": "LSP", "note": "Nomenclature history: The names of Saccharomyces cerevisiae TBP-associated factor (TAF) genes have been changed to reflect guidelines recently enodorsed by the yeast community and published in Genes and Development. An explanation of the changes and a table with old and new gene names for S. cerevisiae, H. sapiens, D. melanogaster, C. elegans, and S. pombe may be found in the paper.", "date_created": "2002-03-25", "references": [{"id": 556641, "display_name": "Tora L (2002)", "citation": "Tora L (2002) A unified nomenclature for TATA box binding protein (TBP)-associated factors (TAFs) involved in RNA polymerase II transcription. Genes Dev 16(6):673-5", "pubmed_id": 11963920, "link": "/reference/S000071622", "year": 2002, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gad.976402"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11963920"}]}]}, {"category": "Mapping", "history_type": "SEQUENCE", "note": "Mapping: Edition 14: TSM1 is also called TAF150", "date_created": "1997-10-20", "references": [{"id": 587084, "display_name": "Cherry JM, et al. (1997)", "citation": "Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73", "pubmed_id": 9169866, "link": "/reference/S000060841", "year": 1997, "urls": [{"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057085/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9169866"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: The systematic sequence was updated in the region between ORFs YCR042C and YCR043C. Note that coordinates listed below are chromosomal coordinates.\r\n
All manually curated literature for the specified gene, organized by relevance to the gene and by
association with specific annotations to the gene in SGD. SGD gathers references via a PubMed search for
papers whose titles or abstracts contain “yeast” or “cerevisiae;” these papers are reviewed manually and
linked to relevant genes and literature topics by SGD curators.
Literature that either focuses on the gene or contains information about function, biological role,
cellular location, phenotype, regulation, structure, or disease homologs in other species for the gene
or gene product.
No primary literature curated.
Genes that share literature (indicated by the purple circles) with the specified gene (indicated by yellow circle).
Click on a gene or a paper to go to its specific page within SGD. Drag any of the gene or paper objects around
within the visualization for easier viewing and click “Reset” to automatically redraw the diagram.
Papers that show experimental evidence for the gene or describe homologs in other species, but
for which the gene is not the paper’s principal focus.
No additional literature curated. No reviews curated.
Paper(s) associated with one or more GO (Gene Ontology) terms in SGD for the specified gene.
No gene ontology literature curated.
Paper(s) associated with one or more pieces of classical phenotype evidence in SGD for the specified gene.
No phenotype literature curated.
Paper(s) associated with evidence supporting a physical or genetic interaction between the
specified gene and another gene in SGD. Currently, all interaction evidence is obtained from
BioGRID.
No interaction literature curated.
Paper(s) associated with one or more pieces of regulation evidence in SGD, as found on the
Regulation page.
No regulation literature curated.
Paper(s) associated with one or more pieces of post-translational modifications evidence in SGD.
No post-translational modifications literature curated.
Paper(s) associated with one or more pieces of high-throughput evidence in SGD.
No high-throughput literature curated.\r\nOld: 204327 TTTATTGAATTAAATAAGACTTGATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 204386\r\n ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||\r\nNew: 205589 TTTATTGAATTAAATAAGACT-GATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 205647", "date_created": "2005-12-31", "references": []}], "complexes": [{"format_name": "CPX-1642", "display_name": "General transcription factor complex TFIID"}]}
TAF2 / YCR042C Literature
Primary Literature
Related Literature
Reset
Additional Literature
Reviews
Gene Ontology Literature
Phenotype Literature
Interaction Literature
Regulation Literature
Post-translational Modifications Literature
High-Throughput Literature