\r\nOld: 204327 TTTATTGAATTAAATAAGACTTGATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 204386\r\n ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||\r\nNew: 205589 TTTATTGAATTAAATAAGACT-GATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 205647", "date_created": "2005-12-31", "references": []}], "complexes": [{"format_name": "CPX-1642", "display_name": "General transcription factor complex TFIID"}]},
tabs: {"id": 1267655, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
TAF2 | SGD
TAF2 / YCR042C Overview
Sequence Details
Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
- Summary
- TAF2/YCR042C is located on the right arm of chromosome III, coding sequence is 4224 nucleotides long with 19 nonsynonymous SNPs
Analyze Sequence
S288C only
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
S288C vs. other strains
Protein Details
Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Length (a.a.)
- 1407
- Mol. Weight (Da)
- 161435.5
- Isoelectric Point
- 5.37
- Median Abundance (molecules/cell)
- 1627 +/- 484
- Half-life (hr)
- 5.0
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
taf2-(tsm1ts)
|
taf2-1
|
taf2-I1399D
|
taf2-V1397D
|
taf2-ts1
|
taf2-ts10
|
taf2-ts11
|
... Show all
taf2-ts12
|
taf2-ts2
|
taf2-ts3
|
taf2-ts4
|
taf2-ts5
|
taf2-ts6
|
taf2-ts7
|
taf2-ts8
|
taf2-ts9
|
taf2-ΔC1261
|
taf2-ΔC1281
|
taf2-∆C
Show fewer
View all TAF2 alleles in SGD search
Gene Ontology Details
Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Chromatin-binding RNA polymerase II transcription initiation factor involved in assembly of preinitiation complex; subunit of transcription factor TFIID
View computational annotations
Molecular Function
- Manually Curated
-
enables
chromatin binding
(IDA)
Biological Process
- Manually Curated
-
involved in
transcription by RNA polymerase II
(IDA)
Cellular Component
- Manually Curated
-
part of
transcription factor TFIID complex
(IDA)
Complex
Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.
Phenotype Details
Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
Classical Genetics
Large-scale Survey
- overexpression
- repressible
- conditional
Interaction Details
Interaction
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
163 total interactions for 58 unique genes
Physical Interactions
- Affinity Capture-MS: 110
- Affinity Capture-RNA: 7
- Affinity Capture-Western: 28
- Biochemical Activity: 1
- Co-localization: 1
- Co-purification: 4
- Far Western: 1
- Reconstituted Complex: 2
- Two-hybrid: 2
Genetic Interactions
- Dosage Rescue: 2
- Negative Genetic: 1
- Synthetic Growth Defect: 1
- Synthetic Lethality: 3
Regulation Details
Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Regulators
-
3
- Targets
-
0
Expression Details
Expression
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
Summary Paragraph
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2009-10-02
Literature Details
Literature
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
Resources
