See More

TFIID is a transcription factor complex that is required for RNAPII-mediated transcription of protein-coding genes and some small nuclear RNAs (reviewed in 4). The complex is composed of Spt15p (TATA binding protein; TBP) and 14 TBP-associated factors (TAFs): Taf1p, Taf2p, Taf3p, Taf4p, Taf5p, Taf6p, Taf7p, Taf8p, Taf9p, Taf10p, Taf11p, Taf12p, Taf13p, Taf14p (7, 10). The TFIID complex is required for basal transcription, but some individual subunits regulate the activated transcription of a subset of genes (13, 16, 17, 18, 19).Recognition of promoter DNA by the TFIID complex is required for the formation of the preinitiation complex (PIC) during transcription initiation (3, 6). The interaction between the TFIID complex and the promoter is stabilized by TFIIA (6, 11). The recruitment of TFIID to promoters is dependent on an upstream activating sequence in the promoter region (14). A subset of the TAFs (Taf5p, Taf6p, Taf9p, Taf10p, and Taf12p) are subunits of both TFIID and the the Spt-Ada-Gcn5-acetyltransferase (SAGA) transcriptional regulatory complex, which functions in nucleosomal histone acetylation and chromatin-associated transcriptional activation or repression (5, 8, 9). The results of genome-wide studies indicate that TFIID functions primarily at the TATA-less promoters of stress-repressed housekeeping genes, representing about 90% of the yeast genome, while SAGA predominates at highly-regulated, stress-responsive TATA box-containing genes, representing about 10% of the genome (12, 15).", "date_edited": "2009-10-02"}, "literature_overview": {"primary_count": 22, "additional_count": 38, "review_count": 30, "go_count": 5, "phenotype_count": 2, "disease_count": 0, "interaction_count": 51, "regulation_count": 4, "ptm_count": 9, "funComplement_count": 0, "htp_count": 8, "total_count": 141}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "genetic_position": 31.0, "regulation_overview": {"regulator_count": 3, "target_count": 0}, "reference_mapping": {"556641": 1, "549611": 2, "550252": 3, "593632": 4, "622591": 5, "470615": 6, "560352": 7, "555555": 8, "542570": 9, "536779": 10, "608643": 11, "545213": 12, "585367": 13, "554485": 14, "467934": 15, "616059": 16, "553618": 17, "609871": 18, "601509": 19, "627302": 20}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: TAF150", "date_created": "2010-02-16", "references": []}, {"category": "Name", "history_type": "LSP", "note": "Name: TAF2", "date_created": "2000-05-19", "references": [{"id": 556641, "display_name": "Tora L (2002)", "citation": "Tora L (2002) A unified nomenclature for TATA box binding protein (TBP)-associated factors (TAFs) involved in RNA polymerase II transcription. Genes Dev 16(6):673-5", "pubmed_id": 11963920, "link": "/reference/S000071622", "year": 2002, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gad.976402"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11963920"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: TafII150", "date_created": "2010-02-16", "references": []}, {"category": "Name", "history_type": "LSP", "note": "Name: TSM1", "date_created": "2010-02-16", "references": [{"id": 627302, "display_name": "Ray BL, et al. (1991)", "citation": "Ray BL, et al. (1991) The TSM1 gene of Saccharomyces cerevisiae overlaps the MAT locus. Curr Genet 20(1-2):25-31", "pubmed_id": 1840512, "link": "/reference/S000046664", "year": 1991, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00312761"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1840512"}]}]}, {"category": "Nomenclature history", "history_type": "LSP", "note": "Nomenclature history: The names of Saccharomyces cerevisiae TBP-associated factor (TAF) genes have been changed to reflect guidelines recently enodorsed by the yeast community and published in Genes and Development. An explanation of the changes and a table with old and new gene names for S. cerevisiae, H. sapiens, D. melanogaster, C. elegans, and S. pombe may be found in the paper.", "date_created": "2002-03-25", "references": [{"id": 556641, "display_name": "Tora L (2002)", "citation": "Tora L (2002) A unified nomenclature for TATA box binding protein (TBP)-associated factors (TAFs) involved in RNA polymerase II transcription. Genes Dev 16(6):673-5", "pubmed_id": 11963920, "link": "/reference/S000071622", "year": 2002, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gad.976402"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11963920"}]}]}, {"category": "Mapping", "history_type": "SEQUENCE", "note": "Mapping: Edition 14: TSM1 is also called TAF150", "date_created": "1997-10-20", "references": [{"id": 587084, "display_name": "Cherry JM, et al. (1997)", "citation": "Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73", "pubmed_id": 9169866, "link": "/reference/S000060841", "year": 1997, "urls": [{"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057085/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9169866"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: The systematic sequence was updated in the region between ORFs YCR042C and YCR043C. Note that coordinates listed below are chromosomal coordinates.\r\n

\r\nOld:   204327 TTTATTGAATTAAATAAGACTTGATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 204386\r\n              ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||\r\nNew:   205589 TTTATTGAATTAAATAAGACT-GATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 205647", "date_created": "2005-12-31", "references": []}], "complexes": [{"format_name": "CPX-1642", "display_name": "General transcription factor complex TFIID"}]};



	
	
	
    
    
	
    TAF2 Homology | SGD
    
	
	
	
	
	








	

    
    

        

            

              
              
            

            

                AboutBlogDownloadExploreHelpGet Data
                
            

        

    

    

        

            
                
            
            

            

                
        

        

        
        

    



	

    	






	










     


     
     


        

        
	
	    	
           
TAF2 / YCR042C Homology

           

	
	   

	     

	        
		
		    
Standard Name

		    
TAF2
		        
			   
			   
			   
    
        
            1
        

    

			

                

		
Systematic Name

                
YCR042C


		
SGD ID

                
SGD:S000000638


                
                    
Aliases


                    TSM1
                    
		    
    
        
            20
        

    
,
                
                    

                    TAF150
                    
		    ,
                
                    

                    TafII150
                    
		    

                
Feature Type

                    
ORF
			    
                            
                        , Verified
			    
                            
                        
                    

                

		
Description

                

                    TFIID subunit (150 kDa); involved in RNA polymerase II transcription initiation
                    
                        
			
                        
    
        
            1
        

    

    
        
            2
        

    

                    
                


                
                    
Name Description

                    
TATA binding protein-Associated Factor
                        
                            
			    
                            
                        
                    

                

                

                

		 
                    
Comparative Info

		
                

		    
		       
                           
                       
                    
		       
			   
		       
                    
		       
			   
		       
                    
		       
			   
		       
                    
		       
                           
		       
                    
		       
			   
		       
                    
		       
		           
		       
                    
                

      	     

	   

        


	
        

        
Homologs
            
            

	       Homology calls are sourced from the Alliance of Genome Resources. Many aspects of data integration presented at the Alliance require a common set of orthology relationships among genes for the organisms represented, including human. The Alliance provides the results of all methods that have been benchmarked by the Quest for Orthologs Consortium (QfO). The homolog inferences from the different methods have been integrated using the DRSC Integrative Ortholog Prediction Tool (DIOPT), which integrates a number of existing methods including those used by the Alliance: Ensembl Compara, HGNC, Hieranoid, InParanoid, OMA, OrthoFinder, OrthoInspector, PANTHER, PhylomeDB, Roundup, TreeFam, and ZFIN.
            

            
	
        

	    

                
                
                

    
    Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
    page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
    sort by that column; filter the table using the "Filter" box at the top of the table.






    
    

        
    
    Species
    Gene ID
    Gene name
    Source

    

    






            


	

	
	
        

        
Functional Complementation
            
            

	       Information about cross-species functional complementation between yeast and other species, curated by SGD and the Princeton Protein Orthology Database (P-POD).
            

            

	        
        

            

                
                
                

    
    Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
    page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
    sort by that column; filter the table using the "Filter" box at the top of the table.






    
    

        
    
    
    Gene
    Species
    Gene ID
    Strain background
    Direction
    Details
    Source
    Reference

    

    






            


	



	
        

        
Fungal Homologs
            
            

               Fungal Homology calls are sourced from AllianceMine, which compiles fungal homology calls from FungiDB, CGD, Panther, PomBase, TreeFam, HomoloGene, and SGD.
            

            
	
        

            

		
		
                

    
    Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
    page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
    sort by that column; filter the table using the "Filter" box at the top of the table.






    
    

        
    
    Species
    Gene ID
    Gene name
    Description
    Source

    

    






            

	    
        


	
        

        
External Identifiers
            
            

                List of external identifiers for the protein from various database sources.
            

            
	
	

            

                
                
                

    
    Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
    page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
    sort by that column; filter the table using the "Filter" box at the top of the table.






    
    

        
    
    External ID
    Source

    

    






            

        

	
        
        

        
Resources

        


        

          
	      
                  
Homologs
 
                 AGD | 
                 
              
                 
                 AnalogYeast | 
                 
              
                 
                 BLASTP at NCBI | 
                 
              
                 
                 CGD | 
                 
              
                 
                 FungiDB | 
                 
              
                 
                 PhylomeDB | 
                 
              
                 
                 PomBase | 
                 
              
                 
                 YGOB | 
                 
              
                 
                 YOGY
                 

              
              
                  
Protein Databases
 
                 AlphaFold Protein Structure | 
                 
              
                 
                 GPMDB | 
                 
              
                 
                 ModelArchive | 
                 
              
                 
                 Pfam domains | 
                 
              
                 
                 SUPERFAMILY | 
                 
              
                 
                 TopologYeast | 
                 
              
                 
                 UniProtKB
                 

              

              
                  
Localization
 
 
                 CYCLoPs | 
                 
              
                 
                 dHITS | 
                 
              
                 
                 LoQAtE | 
                 
              
                 
                 YeastGFP | 
                 
              
                 
                 YeastRC Public Images | 
                 
              
                 
                 YeastRGB | 
                 
              
                 
                 YPL+
                 

              

              
                  
Post-translational Modifications
 
 
                 CoSMoS.c. | 
                 
              
                 
                 PhosphoGRID | 
                 
              
                 
                 PhosphoPep
                 

              

              
                 
S288C only

                 BLASTN | 
              
                 
                 BLASTP | 
              
                 
                 Design Primers | 
              
                 
                 Restriction Fragment Map | 
              
                 
                 Restriction Fragment Sizes | 
              
                 
                 Six-Frame Translation 
 
              

              
                 
S288C vs. other species
 

                 BLASTN vs. fungi | 
              
                 
                 BLASTP at NCBI | 
              
                 
                 BLASTP vs. fungi 
 
              

              
                 
S288C vs. other strains

		 Strain Alignment | 
              
                 
		 Variant Viewer 
 
              

          
        
	      
        


    





    	
    

    
	
	

    

    
    

    
    

    

        © Stanford University, Stanford, CA 94305.