TFIID is a transcription factor complex that is required for RNAPII-mediated transcription of protein-coding genes and some small nuclear RNAs (reviewed in 4). The complex is composed of Spt15p (TATA binding protein; TBP) and 14 TBP-associated factors (TAFs): Taf1p, Taf2p, Taf3p, Taf4p, Taf5p, Taf6p, Taf7p, Taf8p, Taf9p, Taf10p, Taf11p, Taf12p, Taf13p, Taf14p (7, 10). The TFIID complex is required for basal transcription, but some individual subunits regulate the activated transcription of a subset of genes (13, 16, 17, 18, 19).Recognition of promoter DNA by the TFIID complex is required for the formation of the preinitiation complex (PIC) during transcription initiation (3, 6). The interaction between the TFIID complex and the promoter is stabilized by TFIIA (6, 11). The recruitment of TFIID to promoters is dependent on an upstream activating sequence in the promoter region (14). A subset of the TAFs (Taf5p, Taf6p, Taf9p, Taf10p, and Taf12p) are subunits of both TFIID and the the Spt-Ada-Gcn5-acetyltransferase (SAGA) transcriptional regulatory complex, which functions in nucleosomal histone acetylation and chromatin-associated transcriptional activation or repression (5, 8, 9). The results of genome-wide studies indicate that TFIID functions primarily at the TATA-less promoters of stress-repressed housekeeping genes, representing about 90% of the yeast genome, while SAGA predominates at highly-regulated, stress-responsive TATA box-containing genes, representing about 10% of the genome (12, 15).", "date_edited": "2009-10-02"}, "literature_overview": {"primary_count": 22, "additional_count": 38, "review_count": 30, "go_count": 5, "phenotype_count": 2, "disease_count": 0, "interaction_count": 51, "regulation_count": 4, "ptm_count": 9, "funComplement_count": 0, "htp_count": 8, "total_count": 141}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "genetic_position": 31.0, "regulation_overview": {"regulator_count": 3, "target_count": 0}, "reference_mapping": {"556641": 1, "549611": 2, "550252": 3, "593632": 4, "622591": 5, "470615": 6, "560352": 7, "555555": 8, "542570": 9, "536779": 10, "608643": 11, "545213": 12, "585367": 13, "554485": 14, "467934": 15, "616059": 16, "553618": 17, "609871": 18, "601509": 19, "627302": 20}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: TAF150", "date_created": "2010-02-16", "references": []}, {"category": "Name", "history_type": "LSP", "note": "Name: TAF2", "date_created": "2000-05-19", "references": [{"id": 556641, "display_name": "Tora L (2002)", "citation": "Tora L (2002) A unified nomenclature for TATA box binding protein (TBP)-associated factors (TAFs) involved in RNA polymerase II transcription. Genes Dev 16(6):673-5", "pubmed_id": 11963920, "link": "/reference/S000071622", "year": 2002, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gad.976402"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11963920"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: TafII150", "date_created": "2010-02-16", "references": []}, {"category": "Name", "history_type": "LSP", "note": "Name: TSM1", "date_created": "2010-02-16", "references": [{"id": 627302, "display_name": "Ray BL, et al. (1991)", "citation": "Ray BL, et al. (1991) The TSM1 gene of Saccharomyces cerevisiae overlaps the MAT locus. Curr Genet 20(1-2):25-31", "pubmed_id": 1840512, "link": "/reference/S000046664", "year": 1991, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00312761"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1840512"}]}]}, {"category": "Nomenclature history", "history_type": "LSP", "note": "Nomenclature history: The names of Saccharomyces cerevisiae TBP-associated factor (TAF) genes have been changed to reflect guidelines recently enodorsed by the yeast community and published in Genes and Development. An explanation of the changes and a table with old and new gene names for S. cerevisiae, H. sapiens, D. melanogaster, C. elegans, and S. pombe may be found in the paper.", "date_created": "2002-03-25", "references": [{"id": 556641, "display_name": "Tora L (2002)", "citation": "Tora L (2002) A unified nomenclature for TATA box binding protein (TBP)-associated factors (TAFs) involved in RNA polymerase II transcription. Genes Dev 16(6):673-5", "pubmed_id": 11963920, "link": "/reference/S000071622", "year": 2002, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gad.976402"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11963920"}]}]}, {"category": "Mapping", "history_type": "SEQUENCE", "note": "Mapping: Edition 14: TSM1 is also called TAF150", "date_created": "1997-10-20", "references": [{"id": 587084, "display_name": "Cherry JM, et al. (1997)", "citation": "Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73", "pubmed_id": 9169866, "link": "/reference/S000060841", "year": 1997, "urls": [{"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057085/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9169866"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: The systematic sequence was updated in the region between ORFs YCR042C and YCR043C. Note that coordinates listed below are chromosomal coordinates.\r\n
Disease Annotations consist of three mandatory components: a gene product, a term from the
Disease Ontology (DO) controlled vocabulary and an
evidence code. SGD provides manually curated DO Annotations derived from the
literature.
Manually curated DO annotations reflect our best
understanding of disease association for this gene product.
Manually curated annotations are assigned by SGD curators based on published papers when
available, or by curatorial statements if necessary. Curators periodically review all
manually curated Disease annotations for accuracy and completeness.
Increase the total number of rows showing on this page using the pull-down located below the table, or use the page
scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header
to sort by that column; filter the table using the "Filter" box at the top of the table.
DO annotations from high-throughput experiments are
based on a variety of large scale high-throughput experiments, including
genome-wide experiments. Many of these annotations are made based on DO annotations (or
mappings to DO annotations) assigned by the authors, rather than SGD curators. While SGD
curators read these publications and often work closely with authors to incorporate the
information, each individual annotation may not necessarily be reviewed by a curator.
Increase the total number of rows showing on this page using the pull-down located below the table, or use the page
scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header
to sort by that column; filter the table using the "Filter" box at the top of the table.
Computational DO Annotations are
predictions. These annotations are NOT reviewed by a curator. Currently, all
computational DO annotations for S. cerevisiae are assigned by an external
source (for example, the Alliance of Genome Resources
(Alliance).
Increase the total number of rows showing on this page using the pull-down located below the table, or use the page
scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header
to sort by that column; filter the table using the "Filter" box at the top of the table.
This diagram displays manually curated and high-throughput DO terms (orange circles) that are shared between the given gene (black
circle), other yeast genes (dark blue circles), and human genes (light blue circles).
\r\nOld: 204327 TTTATTGAATTAAATAAGACTTGATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 204386\r\n ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||\r\nNew: 205589 TTTATTGAATTAAATAAGACT-GATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 205647", "date_created": "2005-12-31", "references": []}], "complexes": [{"format_name": "CPX-1642", "display_name": "General transcription factor complex TFIID"}]}
TAF2 / YCR042C Disease
Manually Curated
Evidence ID
Analyze ID
Gene
Gene Systematic Name
Disease Ontology Term
Disease Ontology Term ID
Qualifier
Evidence
Method
Source
Assigned On
Reference
High-throughput
Evidence ID
Analyze ID
Gene
Gene Systematic Name
Disease Ontology Term
Disease Ontology Term ID
Qualifier
Evidence
Method
Source
Assigned On
Reference
Computational
Evidence ID
Analyze ID
Gene
Gene Systematic Name
Disease Ontology Term
Disease Ontology Term ID
Qualifier
Evidence
Method
Source
Assigned On
Reference
Shared Annotations