\r\nNew 220372 ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAGAAAATAGGGAAGCAGAGCATA 220431\r\n |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||\r\nOld 220375 ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAAGAAATAGGGAAGCAGAGCATA 220434", "date_created": "2011-04-07", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
tabs: {"id": 1285631, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
PDR3 | SGD
PDR3 / YBL005W Overview
- Standard Name
- PDR3
1
- Systematic Name
- YBL005W
- SGD ID
- SGD:S000000101
- Aliases
-
AMY2
29
,
TPE2
- Feature Type
- ORF
, Verified
- Description
-
Transcriptional activator of the pleiotropic drug resistance network; regulates expression of ATP-binding cassette (ABC) transporters through binding to cis-acting PDRE sites (PDR responsive elements); has a role in response to drugs and organic solvents; post-translationally up-regulated in cells lacking functional mitochondrial genome; involved in diauxic shift; relative distribution to nucleus increases upon DNA replication stress; APCC(Cdh1) substrate
2
3
4
5
6
7
8
9
10
11
- Name Description
- Pleiotropic Drug Resistance
1
- Paralog
-
PDR1
- Comparative Info
-
Sequence Details
Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
- Summary
- PDR3/YBL005W is located on the left arm of chromosome II, coding sequence is 2931 nucleotides long with 12 nonsynonymous SNPs
Analyze Sequence
S288C only
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
S288C vs. other strains
Protein Details
Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Summary
- Relative distribution to nucleus increases upon DNA replication stress; APCC(Cdh1) substrate
- Length (a.a.)
- 976
- Mol. Weight (Da)
- 112562.2
- Isoelectric Point
- 6.55
- Median Abundance (molecules/cell)
- 225 +/- 190
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
pdr3-1
|
pdr3-18
|
pdr3-2
|
pdr3-7
|
pdr3-9
|
pdr3-A148T,A229V,H336R,L541P
|
pdr3-D853Y
|
... Show all
pdr3-Q763L
|
pdr3-Y276S
|
pdr3-Δ
Show fewer
View all PDR3 alleles in SGD search
Gene Ontology Details
Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Sequence specific DNA-binding polymerase II transcription factor that activates expression of genes involved in drug response
View computational annotations
Molecular Function
- Manually Curated
Biological Process
- Manually Curated
-
involved in
cellular response to xenobiotic stimulus
(IMP)
-
involved in
positive regulation of cellular response to drug
(IGI,
IMP)
-
involved in
positive regulation of transcription by RNA polymerase II
(IMP)
Phenotype Details
Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
- Summary
- Non-essential gene in reference strain S288C; null mutation confers resistance or sensitivity to various drugs; in large-scale studies, null mutation confers decreased competitive fitness in rich glucose medium, increased fitness in minimal medium, and altered resistance to a wide variety of drugs; overexpression causes slow growth
Classical Genetics
- null
- gain of function
- reduction of function
- overexpression
Large-scale Survey
- null
- overexpression
- unspecified
Interaction Details
Interaction
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
- Summary
- The pdr3 null mutant is viable; the null mutant of paralog pdr1 is viable; the pdr3 pdr1 double mutant displays a synthetic growth defect.
141 total interactions for 111 unique genes
Physical Interactions
- Affinity Capture-MS: 3
- Affinity Capture-RNA: 6
- Affinity Capture-Western: 5
- Co-fractionation: 1
- Co-localization: 1
- PCA: 1
- Two-hybrid: 6
Genetic Interactions
- Dosage Lethality: 1
- Dosage Rescue: 4
- Negative Genetic: 45
- Phenotypic Enhancement: 31
- Phenotypic Suppression: 6
- Positive Genetic: 7
- Synthetic Growth Defect: 20
- Synthetic Lethality: 1
- Synthetic Rescue: 3
Regulation Details
Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Summary
- PDR3 encodes a transcription factor that is a member of the C6 zinc finger class, containing a DNA binding domain also known as the Zn2Cys6 binuclear zinc cluster or zinc knuckle. Pdr3p activates transcription of genes involved in pleiotropic drug resistance, such as the ATP-binding cassette transporter genes PDR5, SNQ2, and YOR1, whose products mediate drug efflux from the cell. Pdr3p targets also have roles in hydroxymethylfurfural (HMF) tolerance, ethanol tolerance, the salt stress response, and sphingolipid biosynthesis. Pdr3p binds to multiple PDREs (pleiotropic drug resistance elements) in the promoters of target genes, either as a homodimer or as a heterodimer with its paralog Pdr1p. Regulatory targets of the Pdr3p homodimer include genes involved in retrograde signaling and the DNA damage response. PDR3 transcription is regulated by Pdr1p and is also positively autoregulated.
Expression Details
Expression
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
Summary Paragraph
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2007-09-28
Literature Details
Literature
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
Resources