Snf5p is similar to Sfh1p, Drosophila SNR1, Schizosaccharomyces pombe Snf5p, and Arabidopsis thaliana BSH, which can partially complement the defects seen in snf5 null mutants (42, 45, 46, 49). Snf5p also has a region of similarity to zebrafish SMARCB1 and Caenorhabditis elegans R07E5.3 (24). The human homolog of Snf5p (SMARCB1) is a tumor suppressor, mutation of which is associated with oncogenesis (24, 51). SMARCB1 binds to Epstein-Barr virus (EBV) nuclear protein 2 (EBNA2), which is expressed in latently-infected B lymphocytes and is essential to the immortalization of B cells by EBV (53). Human SMARCB1 also binds to human papillomavirus (HPV) E1 protein in two-hybrid assays and stimulates HPV DNA replication in vitro (55). By regulating the structure of chromatin, chromatin remodeling complexes, all of which contain an ATPase as a central motor subunit, perform critical functions in the maintenance, transmission, and expression of eukaryotic genomes. The SWI/SNF chromatin remodeling complex is involved in DNA replication, stress response, and transcription, and binds DNA nonspecifically, altering nucleosome structure to facilitate binding of transcription factors. For some genes, transcriptional activators are able to target the SWI/SNF complex to upstream activation sequences (UAS) in the promoter. The SWI/SNF chromatin remodeling complex family contains two evolutionary conserved subclasses of chromatin remodeling factors, one subfamily includes yeast SWI/SNF, fly BAP, and mammalian BAF, and the other subfamily includes yeast RSC (Remodel the Structure of Chromatin), fly PBAP, and mammalian PBAF (7, 9, 2, 12, 13, 8, 17, 6, 20, 22, 23, 26, 27, 30, 32, 33, 34, 36, 39, 40, 43, 44, 47, 48, 50, 39, 52, 54, 56, 57, 35). It appears that some human SWI/SNF subunits act as tumor suppressors and there is also evidence that human SWI/SNF subunits are involved in controlling cell growth via their interaction with other tumor suppressors (58). Expression of adenovirus E1A oncoproteins, which are regulators of cellular and viral transcription, in Saccharomyces cerevisiae requires the function of the SWI/SNF complex, and expression of E1A in wild-type cells leads to a specific loss of SWI/SNF dependent transcription. These results suggest that the SWI/SNF complex is a target of these oncoproteins in mammalian cells and that the disruption of normal cell cycle control by E1A may be due in part to altered activity of the SWI/SNF complex (59).", "date_edited": "2006-03-27"}, "literature_overview": {"primary_count": 91, "additional_count": 123, "review_count": 59, "go_count": 14, "phenotype_count": 12, "disease_count": 0, "interaction_count": 110, "regulation_count": 5, "ptm_count": 8, "funComplement_count": 0, "htp_count": 53, "total_count": 389}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 4, "target_count": 1, "paragraph": {"text": "SNF5 promoter is bound by Fkh1p; SNF5 promoter is bound by Xbp1p in response to heat; SNF5 transcription is regulated by Spt10p; SNF5 transcription is downregulated by Ixr1p in response to hypoxia", "date_edited": "2023-08-31", "references": [{"id": 371969, "display_name": "Ostrow AZ, et al. (2014)", "citation": "Ostrow AZ, et al. (2014) Fkh1 and Fkh2 bind multiple chromosomal elements in the S. cerevisiae genome with distinct specificities and cell cycle dynamics. PLoS One 9(2):e87647", "pubmed_id": 24504085, "link": "/reference/S000156933", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1371/journal.pone.0087647"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3913637/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24504085"}]}, {"id": 414327, "display_name": "Venters BJ, et al. (2011)", "citation": "Venters BJ, et al. (2011) A comprehensive genomic binding map of gene and chromatin regulatory proteins in Saccharomyces. Mol Cell 41(4):480-92", "pubmed_id": 21329885, "link": "/reference/S000145602", "year": 2011, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/j.molcel.2011.01.015"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057419/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/21329885"}]}, {"id": 524734, "display_name": "Mendiratta G, et al. (2006)", "citation": "Mendiratta G, et al. (2006) The DNA-binding domain of the yeast Spt10p activator includes a zinc finger that is homologous to foamy virus integrase. J Biol Chem 281(11):7040-8", "pubmed_id": 16415340, "link": "/reference/S000114259", "year": 2006, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1074/jbc.M511416200"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/16415340"}]}, {"id": 407966, "display_name": "Vizoso-V\u00e1zquez A, et al. (2012)", "citation": "Vizoso-V\u00e1zquez A, et al. (2012) Ixr1p and the control of the Saccharomyces cerevisiae hypoxic response. Appl Microbiol Biotechnol 94(1):173-84", "pubmed_id": 22189861, "link": "/reference/S000147832", "year": 2012, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/s00253-011-3785-2"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/22189861"}]}]}}, "reference_mapping": {"638930": 1, "636694": 2, "595387": 3, "617905": 4, "397497": 5, "616820": 6, "611245": 7, "600257": 8, "572435": 9, "553639": 10, "627050": 11, "591652": 12, "589270": 13, "622573": 14, "641072": 15, "646971": 16, "636210": 17, "628984": 18, "639439": 19, "615870": 20, "623641": 21, "635012": 22, "613366": 23, "586406": 24, "544367": 25, "619148": 26, "604412": 27, "531990": 28, "641962": 29, "593591": 30, "628236": 31, "584881": 32, "584872": 33, "580378": 34, "643583": 35, "547947": 36, "619652": 37, "631343": 38, "546954": 39, "546548": 40, "528249": 41, "614034": 42, "536087": 43, "529681": 44, "607071": 45, "601566": 46, "584878": 47, "584875": 48, "610689": 49, "584863": 50, "528240": 51, "639568": 52, "626727": 53, "584884": 54, "525675": 55, "636189": 56, "601809": 57, "556456": 58, "611554": 59, "599335": 60, "624823": 61, "601740": 62}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: HAF4", "date_created": "2010-02-16", "references": [{"id": 599335, "display_name": "Kuchin SV, et al. (1993)", "citation": "Kuchin SV, et al. (1993) Genes required for derepression of an extracellular glucoamylase gene, STA2, in the yeast Saccharomyces. Yeast 9(5):533-41", "pubmed_id": 8322516, "link": "/reference/S000056109", "year": 1993, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1002/yea.320090510"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/8322516"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SNF5", "date_created": "2000-05-19", "references": [{"id": 638930, "display_name": "Neigeborn L and Carlson M (1984)", "citation": "Neigeborn L and Carlson M (1984) Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae. Genetics 108(4):845-58", "pubmed_id": 6392017, "link": "/reference/S000042746", "year": 1984, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1093/genetics/108.4.845"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1224269/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/6392017"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SWI10", "date_created": "2010-02-16", "references": [{"id": 622573, "display_name": "Breeden L and Nasmyth K (1987)", "citation": "Breeden L and Nasmyth K (1987) Cell cycle control of the yeast HO gene: cis- and trans-acting regulators. Cell 48(3):389-97", "pubmed_id": 3542227, "link": "/reference/S000048261", "year": 1987, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/0092-8674(87)90190-5"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/3542227"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: TYE4", "date_created": "2010-02-16", "references": [{"id": 601740, "display_name": "Ciriacy M and Williamson VM (1981)", "citation": "Ciriacy M and Williamson VM (1981) Analysis of mutations affecting Ty-mediated gene expression in Saccharomyces cerevisiae. Mol Gen Genet 182(1):159-63", "pubmed_id": 6267430, "link": "/reference/S000055296", "year": 1981, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00422784"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/6267430"}]}, {"id": 624823, "display_name": "Ciriacy M, et al. (1991)", "citation": "Ciriacy M, et al. (1991) Characterization of trans-acting mutations affecting Ty and Ty-mediated transcription in Saccharomyces cerevisiae. Curr Genet 20(6):441-8", "pubmed_id": 1664298, "link": "/reference/S000047501", "year": 1991, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00334769"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1664298"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Two nucleotide substitutions within the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all SNF5 alleles in SGD search
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
View computational annotations
Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
692 total interactions for 519 unique genes
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2006-03-27
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
\r\nNew 780521 ACAACCTCCCACCAATGTTCAGCCAACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA 780580\r\n |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||\r\nOld 780517 ACAACCTCCCACCAATGTTCAGCCCACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA 780576\r\n\r\nNew 781311 GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGACATCTCTAATAGT 781370\r\n ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||\r\nOld 781307 GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGAGATCTCTAATAGT 781366", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-1150", "display_name": "SWI/SNF chromatin remodelling complex"}]},
tabs: {"id": 1267005, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
SNF5 / YBR289W Overview
Sequence
Analyze Sequence
S288C only
S288C vs. other species
S288C vs. other strains
Protein
Alleles
Gene Ontology
Molecular Function
Biological Process
Complex
Phenotype
Classical Genetics
Large-scale Survey
Interaction
Physical Interactions
Genetic Interactions
Regulation
Expression
Summary Paragraph
Literature
Resources