Snf5p is similar to Sfh1p, Drosophila SNR1, Schizosaccharomyces pombe Snf5p, and Arabidopsis thaliana BSH, which can partially complement the defects seen in snf5 null mutants (42, 45, 46, 49). Snf5p also has a region of similarity to zebrafish SMARCB1 and Caenorhabditis elegans R07E5.3 (24). The human homolog of Snf5p (SMARCB1) is a tumor suppressor, mutation of which is associated with oncogenesis (24, 51). SMARCB1 binds to Epstein-Barr virus (EBV) nuclear protein 2 (EBNA2), which is expressed in latently-infected B lymphocytes and is essential to the immortalization of B cells by EBV (53). Human SMARCB1 also binds to human papillomavirus (HPV) E1 protein in two-hybrid assays and stimulates HPV DNA replication in vitro (55). By regulating the structure of chromatin, chromatin remodeling complexes, all of which contain an ATPase as a central motor subunit, perform critical functions in the maintenance, transmission, and expression of eukaryotic genomes. The SWI/SNF chromatin remodeling complex is involved in DNA replication, stress response, and transcription, and binds DNA nonspecifically, altering nucleosome structure to facilitate binding of transcription factors. For some genes, transcriptional activators are able to target the SWI/SNF complex to upstream activation sequences (UAS) in the promoter. The SWI/SNF chromatin remodeling complex family contains two evolutionary conserved subclasses of chromatin remodeling factors, one subfamily includes yeast SWI/SNF, fly BAP, and mammalian BAF, and the other subfamily includes yeast RSC (Remodel the Structure of Chromatin), fly PBAP, and mammalian PBAF (7, 9, 2, 12, 13, 8, 17, 6, 20, 22, 23, 26, 27, 30, 32, 33, 34, 36, 39, 40, 43, 44, 47, 48, 50, 39, 52, 54, 56, 57, 35). It appears that some human SWI/SNF subunits act as tumor suppressors and there is also evidence that human SWI/SNF subunits are involved in controlling cell growth via their interaction with other tumor suppressors (58). Expression of adenovirus E1A oncoproteins, which are regulators of cellular and viral transcription, in Saccharomyces cerevisiae requires the function of the SWI/SNF complex, and expression of E1A in wild-type cells leads to a specific loss of SWI/SNF dependent transcription. These results suggest that the SWI/SNF complex is a target of these oncoproteins in mammalian cells and that the disruption of normal cell cycle control by E1A may be due in part to altered activity of the SWI/SNF complex (59).", "date_edited": "2006-03-27"}, "literature_overview": {"primary_count": 91, "additional_count": 123, "review_count": 59, "go_count": 14, "phenotype_count": 12, "disease_count": 0, "interaction_count": 110, "regulation_count": 5, "ptm_count": 8, "funComplement_count": 0, "htp_count": 53, "total_count": 389}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 4, "target_count": 1, "paragraph": {"text": "SNF5 promoter is bound by Fkh1p; SNF5 promoter is bound by Xbp1p in response to heat; SNF5 transcription is regulated by Spt10p; SNF5 transcription is downregulated by Ixr1p in response to hypoxia", "date_edited": "2023-08-31", "references": [{"id": 371969, "display_name": "Ostrow AZ, et al. (2014)", "citation": "Ostrow AZ, et al. (2014) Fkh1 and Fkh2 bind multiple chromosomal elements in the S. cerevisiae genome with distinct specificities and cell cycle dynamics. PLoS One 9(2):e87647", "pubmed_id": 24504085, "link": "/reference/S000156933", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1371/journal.pone.0087647"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3913637/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24504085"}]}, {"id": 414327, "display_name": "Venters BJ, et al. (2011)", "citation": "Venters BJ, et al. (2011) A comprehensive genomic binding map of gene and chromatin regulatory proteins in Saccharomyces. Mol Cell 41(4):480-92", "pubmed_id": 21329885, "link": "/reference/S000145602", "year": 2011, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/j.molcel.2011.01.015"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057419/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/21329885"}]}, {"id": 524734, "display_name": "Mendiratta G, et al. (2006)", "citation": "Mendiratta G, et al. (2006) The DNA-binding domain of the yeast Spt10p activator includes a zinc finger that is homologous to foamy virus integrase. J Biol Chem 281(11):7040-8", "pubmed_id": 16415340, "link": "/reference/S000114259", "year": 2006, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1074/jbc.M511416200"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/16415340"}]}, {"id": 407966, "display_name": "Vizoso-V\u00e1zquez A, et al. (2012)", "citation": "Vizoso-V\u00e1zquez A, et al. (2012) Ixr1p and the control of the Saccharomyces cerevisiae hypoxic response. Appl Microbiol Biotechnol 94(1):173-84", "pubmed_id": 22189861, "link": "/reference/S000147832", "year": 2012, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/s00253-011-3785-2"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/22189861"}]}]}}, "reference_mapping": {"638930": 1, "636694": 2, "595387": 3, "617905": 4, "397497": 5, "616820": 6, "611245": 7, "600257": 8, "572435": 9, "553639": 10, "627050": 11, "591652": 12, "589270": 13, "622573": 14, "641072": 15, "646971": 16, "636210": 17, "628984": 18, "639439": 19, "615870": 20, "623641": 21, "635012": 22, "613366": 23, "586406": 24, "544367": 25, "619148": 26, "604412": 27, "531990": 28, "641962": 29, "593591": 30, "628236": 31, "584881": 32, "584872": 33, "580378": 34, "643583": 35, "547947": 36, "619652": 37, "631343": 38, "546954": 39, "546548": 40, "528249": 41, "614034": 42, "536087": 43, "529681": 44, "607071": 45, "601566": 46, "584878": 47, "584875": 48, "610689": 49, "584863": 50, "528240": 51, "639568": 52, "626727": 53, "584884": 54, "525675": 55, "636189": 56, "601809": 57, "556456": 58, "611554": 59, "599335": 60, "624823": 61, "601740": 62}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: HAF4", "date_created": "2010-02-16", "references": [{"id": 599335, "display_name": "Kuchin SV, et al. (1993)", "citation": "Kuchin SV, et al. (1993) Genes required for derepression of an extracellular glucoamylase gene, STA2, in the yeast Saccharomyces. Yeast 9(5):533-41", "pubmed_id": 8322516, "link": "/reference/S000056109", "year": 1993, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1002/yea.320090510"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/8322516"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SNF5", "date_created": "2000-05-19", "references": [{"id": 638930, "display_name": "Neigeborn L and Carlson M (1984)", "citation": "Neigeborn L and Carlson M (1984) Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae. Genetics 108(4):845-58", "pubmed_id": 6392017, "link": "/reference/S000042746", "year": 1984, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1093/genetics/108.4.845"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1224269/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/6392017"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SWI10", "date_created": "2010-02-16", "references": [{"id": 622573, "display_name": "Breeden L and Nasmyth K (1987)", "citation": "Breeden L and Nasmyth K (1987) Cell cycle control of the yeast HO gene: cis- and trans-acting regulators. Cell 48(3):389-97", "pubmed_id": 3542227, "link": "/reference/S000048261", "year": 1987, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/0092-8674(87)90190-5"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/3542227"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: TYE4", "date_created": "2010-02-16", "references": [{"id": 601740, "display_name": "Ciriacy M and Williamson VM (1981)", "citation": "Ciriacy M and Williamson VM (1981) Analysis of mutations affecting Ty-mediated gene expression in Saccharomyces cerevisiae. Mol Gen Genet 182(1):159-63", "pubmed_id": 6267430, "link": "/reference/S000055296", "year": 1981, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00422784"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/6267430"}]}, {"id": 624823, "display_name": "Ciriacy M, et al. (1991)", "citation": "Ciriacy M, et al. (1991) Characterization of trans-acting mutations affecting Ty and Ty-mediated transcription in Saccharomyces cerevisiae. Curr Genet 20(6):441-8", "pubmed_id": 1664298, "link": "/reference/S000047501", "year": 1991, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00334769"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1664298"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Two nucleotide substitutions within the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.
Protein abundance data, domains, shared domains with other proteins, protein sequence retrieval for
various strains, sequence-based physico-chemical properties, protein modification sites, and external
identifiers for the protein.
AlphaFold, developed by DeepMind, is an AI program that accurately predicts protein structures from amino acid sequences, enabling visualization of protein conformations. The predicted structures can be accessed through the Protein Data Bank (PDB) and AlphaFold Protein Structure Database.
Contains experimentally-derived protein half-life data obtained using stable isotope labeling by amino acids (SILAC) coupled with mass spectrometry. This section also contains protein abundance data for both untreated and treated cells obtained from over 20 studies. These data have been normalized and converted to a common unit of molecules per cell.
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
Collection of computationally identified domains and motifs, as determined by InterProScan analysis;
includes protein coordinates for the domain, a domain Description, a Source and corresponding accession
ID, and the number of S. cerevisiae genes that share the same domain.
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
Visual representation of the locations of the domains within the protein, as listed in
the Domains and Classification table. Each row displays the domain(s) derived from a
different Source, with domains color-coded according to this Source.
Scroll over a domain to view its exact coordinates and its Description.
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all SNF5 alleles in SGD search
Protein sequence for the given gene in S288C and other strains, when available. Use the pull-down menu under "Strain" to select the sequence for a specific strain. The displayed sequence can be downloaded in FASTA format as a .txt file. Amino acids displayed in blue represent modification sites. More detailed evidence for these modification sites is presented in the Post-translational Modifications table, located just below the protein sequence.
This locus is not translated into a protein. * Blue amino acids indicate modification sites. More information below.
Modification sites for the protein in the selected strain, based on the presence of a residue in the specific strain, as inferred from experimental evidence.
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
Calculated protein properties, including amino acid composition, length, coding
region calculations, and atomic composition.
Sort table using the arrow to the right of a column header to sort by that column; download all properties as a
.txt file using the "Download Properties" button.
Sort table using the arrow to the right of a column header to sort by that column; download all properties as a
.txt file using the "Download Properties" button.
Data not found or not available for
List of external identifiers for the protein from various database sources.
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
AGD |
AnalogYeast |
BLASTP at NCBI |
CGD |
FungiDB |
PhylomeDB |
PomBase |
YGOB |
YOGY
AlphaFold Protein Structure |
GPMDB |
ModelArchive |
Pfam domains |
SUPERFAMILY |
TopologYeast |
UniProtKB
CYCLoPs |
dHITS |
LoQAtE |
YeastGFP |
YeastRC Public Images |
YeastRGB |
YPL+
\r\nNew 780521 ACAACCTCCCACCAATGTTCAGCCAACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA 780580\r\n |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||\r\nOld 780517 ACAACCTCCCACCAATGTTCAGCCCACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA 780576\r\n\r\nNew 781311 GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGACATCTCTAATAGT 781370\r\n ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||\r\nOld 781307 GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGAGATCTCTAATAGT 781366", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-1150", "display_name": "SWI/SNF chromatin remodelling complex"}]};
var domains_table_filename = "SNF5_domains";
var alias_table_filename = "SNF5_external_ids";
var domain_network_filename = "SNF5_domain_network";
var properties_table_filename = "SNF5_protein_properties";
var protein_experiment_table_filename = "SNF5_experimental_data";
var protein_abundance_table_filename = "SNF5_abundance_data";
var phosphorylation_table_filename = "SNF5_phosphorylation";
var display_name = "SNF5";
var format_name = "YBR289W";
var locus_id = "1267005";
function customize() {
if (window.viewerInstance && viewerInstance.canvas) {
viewerInstance.canvas.setBgColor({ r: 255, g: 255, b: 255 });
}
}
SNF5 / YBR289W
Protein
AlphaFold Protein Structure
Experimental Data
Protein Half Life
Evidence ID
Analyze ID
Gene
Gene Systematic Name
Experiment
Result
Reference
Protein Abundance
Evidence ID
Analyze ID
Gene
Gene Systematic Name
Abundance (molecules/cell)
Media
Treatment
Treatment time
Fold Change
Visualization
Strain background
Original Reference
Reference
Domains and Classification - S288C
Evidence ID
Analyze ID
Gene
Gene Systematic Name
Protein Coordinates
Accession ID
Description
Source
No. of Genes with Domain
Domain Locations
Alleles
Sequence
Post-translational Modifications -
Site
Modification
Modifier
Source
Reference
Sequence-Based Physico-chemical Properties - S288C
Amino Acid Composition
Amino Acid
Frequency
Percentage
Physical Details
Length (a.a): Molecular Weight (Da): Isoelectric Point (pl): Formula: Aliphatic Index: Instability Index: Coding Region Translation Calculations
Codon Bias: Codon Adaptation Index: Frequence of Optimal Codons: Hydropathicity of Protein: Aromaticity Score: Extinction Coefficients at 280nm
ALL Cys residues appear as half cystines: NO Cys residues appear as half cystines: Atomic Composition
Atom
Frequency
Percentage
External Identifiers
Alias ID
External ID
Source
Resources
Homologs
Protein Databases
Localization
Post-translational Modifications