See More

snf5 null mutants are viable, but display reduced growth on glucose and sucrose, are unable to grow on raffinose, galactose, or glycerol, and are hypersensitive to lithium and calcium ions (1, 11, 35). snf5 null mutations are synthetically lethal in combination with dst1 null mutations (37, 38), and expression of an active Moloney murine leukemia virus (M-MuLV) integrase (IN) is lethal in rad52 null mutants, but not in rad52 snf5 double null mutants (41).

Snf5p is similar to Sfh1p, Drosophila SNR1, Schizosaccharomyces pombe Snf5p, and Arabidopsis thaliana BSH, which can partially complement the defects seen in snf5 null mutants (42, 45, 46, 49). Snf5p also has a region of similarity to zebrafish SMARCB1 and Caenorhabditis elegans R07E5.3 (24). The human homolog of Snf5p (SMARCB1) is a tumor suppressor, mutation of which is associated with oncogenesis (24, 51). SMARCB1 binds to Epstein-Barr virus (EBV) nuclear protein 2 (EBNA2), which is expressed in latently-infected B lymphocytes and is essential to the immortalization of B cells by EBV (53). Human SMARCB1 also binds to human papillomavirus (HPV) E1 protein in two-hybrid assays and stimulates HPV DNA replication in vitro (55). By regulating the structure of chromatin, chromatin remodeling complexes, all of which contain an ATPase as a central motor subunit, perform critical functions in the maintenance, transmission, and expression of eukaryotic genomes. The SWI/SNF chromatin remodeling complex is involved in DNA replication, stress response, and transcription, and binds DNA nonspecifically, altering nucleosome structure to facilitate binding of transcription factors. For some genes, transcriptional activators are able to target the SWI/SNF complex to upstream activation sequences (UAS) in the promoter. The SWI/SNF chromatin remodeling complex family contains two evolutionary conserved subclasses of chromatin remodeling factors, one subfamily includes yeast SWI/SNF, fly BAP, and mammalian BAF, and the other subfamily includes yeast RSC (Remodel the Structure of Chromatin), fly PBAP, and mammalian PBAF (7, 9, 2, 12, 13, 8, 17, 6, 20, 22, 23, 26, 27, 30, 32, 33, 34, 36, 39, 40, 43, 44, 47, 48, 50, 39, 52, 54, 56, 57, 35).

It appears that some human SWI/SNF subunits act as tumor suppressors and there is also evidence that human SWI/SNF subunits are involved in controlling cell growth via their interaction with other tumor suppressors (58). Expression of adenovirus E1A oncoproteins, which are regulators of cellular and viral transcription, in Saccharomyces cerevisiae requires the function of the SWI/SNF complex, and expression of E1A in wild-type cells leads to a specific loss of SWI/SNF dependent transcription. These results suggest that the SWI/SNF complex is a target of these oncoproteins in mammalian cells and that the disruption of normal cell cycle control by E1A may be due in part to altered activity of the SWI/SNF complex (59).", "date_edited": "2006-03-27"}, "literature_overview": {"primary_count": 91, "additional_count": 123, "review_count": 59, "go_count": 14, "phenotype_count": 12, "disease_count": 0, "interaction_count": 110, "regulation_count": 5, "ptm_count": 8, "funComplement_count": 0, "htp_count": 53, "total_count": 389}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 4, "target_count": 1, "paragraph": {"text": "SNF5 promoter is bound by Fkh1p; SNF5 promoter is bound by Xbp1p in response to heat; SNF5 transcription is regulated by Spt10p; SNF5 transcription is downregulated by Ixr1p in response to hypoxia", "date_edited": "2023-08-31", "references": [{"id": 371969, "display_name": "Ostrow AZ, et al. (2014)", "citation": "Ostrow AZ, et al. (2014) Fkh1 and Fkh2 bind multiple chromosomal elements in the S. cerevisiae genome with distinct specificities and cell cycle dynamics. PLoS One 9(2):e87647", "pubmed_id": 24504085, "link": "/reference/S000156933", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1371/journal.pone.0087647"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3913637/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24504085"}]}, {"id": 414327, "display_name": "Venters BJ, et al. (2011)", "citation": "Venters BJ, et al. (2011) A comprehensive genomic binding map of gene and chromatin regulatory proteins in Saccharomyces. Mol Cell 41(4):480-92", "pubmed_id": 21329885, "link": "/reference/S000145602", "year": 2011, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/j.molcel.2011.01.015"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057419/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/21329885"}]}, {"id": 524734, "display_name": "Mendiratta G, et al. (2006)", "citation": "Mendiratta G, et al. (2006) The DNA-binding domain of the yeast Spt10p activator includes a zinc finger that is homologous to foamy virus integrase. J Biol Chem 281(11):7040-8", "pubmed_id": 16415340, "link": "/reference/S000114259", "year": 2006, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1074/jbc.M511416200"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/16415340"}]}, {"id": 407966, "display_name": "Vizoso-V\u00e1zquez A, et al. (2012)", "citation": "Vizoso-V\u00e1zquez A, et al. (2012) Ixr1p and the control of the Saccharomyces cerevisiae hypoxic response. Appl Microbiol Biotechnol 94(1):173-84", "pubmed_id": 22189861, "link": "/reference/S000147832", "year": 2012, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/s00253-011-3785-2"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/22189861"}]}]}}, "reference_mapping": {"638930": 1, "636694": 2, "595387": 3, "617905": 4, "397497": 5, "616820": 6, "611245": 7, "600257": 8, "572435": 9, "553639": 10, "627050": 11, "591652": 12, "589270": 13, "622573": 14, "641072": 15, "646971": 16, "636210": 17, "628984": 18, "639439": 19, "615870": 20, "623641": 21, "635012": 22, "613366": 23, "586406": 24, "544367": 25, "619148": 26, "604412": 27, "531990": 28, "641962": 29, "593591": 30, "628236": 31, "584881": 32, "584872": 33, "580378": 34, "643583": 35, "547947": 36, "619652": 37, "631343": 38, "546954": 39, "546548": 40, "528249": 41, "614034": 42, "536087": 43, "529681": 44, "607071": 45, "601566": 46, "584878": 47, "584875": 48, "610689": 49, "584863": 50, "528240": 51, "639568": 52, "626727": 53, "584884": 54, "525675": 55, "636189": 56, "601809": 57, "556456": 58, "611554": 59, "599335": 60, "624823": 61, "601740": 62}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: HAF4", "date_created": "2010-02-16", "references": [{"id": 599335, "display_name": "Kuchin SV, et al. (1993)", "citation": "Kuchin SV, et al. (1993) Genes required for derepression of an extracellular glucoamylase gene, STA2, in the yeast Saccharomyces. Yeast 9(5):533-41", "pubmed_id": 8322516, "link": "/reference/S000056109", "year": 1993, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1002/yea.320090510"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/8322516"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SNF5", "date_created": "2000-05-19", "references": [{"id": 638930, "display_name": "Neigeborn L and Carlson M (1984)", "citation": "Neigeborn L and Carlson M (1984) Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae. Genetics 108(4):845-58", "pubmed_id": 6392017, "link": "/reference/S000042746", "year": 1984, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1093/genetics/108.4.845"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1224269/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/6392017"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SWI10", "date_created": "2010-02-16", "references": [{"id": 622573, "display_name": "Breeden L and Nasmyth K (1987)", "citation": "Breeden L and Nasmyth K (1987) Cell cycle control of the yeast HO gene: cis- and trans-acting regulators. Cell 48(3):389-97", "pubmed_id": 3542227, "link": "/reference/S000048261", "year": 1987, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/0092-8674(87)90190-5"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/3542227"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: TYE4", "date_created": "2010-02-16", "references": [{"id": 601740, "display_name": "Ciriacy M and Williamson VM (1981)", "citation": "Ciriacy M and Williamson VM (1981) Analysis of mutations affecting Ty-mediated gene expression in Saccharomyces cerevisiae. Mol Gen Genet 182(1):159-63", "pubmed_id": 6267430, "link": "/reference/S000055296", "year": 1981, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00422784"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/6267430"}]}, {"id": 624823, "display_name": "Ciriacy M, et al. (1991)", "citation": "Ciriacy M, et al. (1991) Characterization of trans-acting mutations affecting Ty and Ty-mediated transcription in Saccharomyces cerevisiae. Curr Genet 20(6):441-8", "pubmed_id": 1664298, "link": "/reference/S000047501", "year": 1991, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00334769"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1664298"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Two nucleotide substitutions within the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.

\r\nNew    780521  ACAACCTCCCACCAATGTTCAGCCAACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA  780580\r\n               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||\r\nOld    780517  ACAACCTCCCACCAATGTTCAGCCCACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA  780576\r\n\r\nNew    781311  GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGACATCTCTAATAGT  781370\r\n               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||\r\nOld    781307  GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGAGATCTCTAATAGT  781366", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-1150", "display_name": "SWI/SNF chromatin remodelling complex"}]};


	
	
	
    
    
	
    SNF5 Phenotypes | SGD
    
	
	
	
	
	








	
Phenotype Help

SNF5 / YBR289W Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided.


Summary
Non-essential gene in reference strain S288C; null mutant displays slow growth, UV sensitivity, defects in using glutamate as nitrogen source, increased cell size, small nucleolus, overexpanded ER with disorganized cytosolic structures, decreased competitive growth, decreased chronological lifespan, abnormal sporulation, decreased respiratory growth, and sensitivity to hydroxyurea, methyl methanesulfonate, azoles, various antifungals, various metals, heat, Congo Red, sorbate, boric acid, caffeine, cycloheximide

Annotations

A phenotype is defined as an observable (e.g., apoptosis) and a qualifier (e.g., increased). There may be more than one row with the same phenotype if that phenotype was observed in separate studies or in different conditions, strains, alleles, etc.


Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details.

Gene Phenotype Experiment Type Mutant Information Strain Background Chemical Details Reference

Shared Phenotypes

This diagram displays phenotype observables (purple squares) that are shared between the given gene (yellow circle) and other genes (gray circles) based on the number of phenotype observables shared (adjustable using the slider at the bottom).


Reset

Click on a gene or phenotype observable name to go to its specific page within SGD; drag any of the gene or observable objects around within the visualization for easier viewing; click “Reset” to automatically redraw the diagram; filter the genes that share observable terms with the given gene by the number of terms they share by clicking anywhere on the slider bar or dragging the tab to the desired filter number.


Resources


© Stanford University, Stanford, CA 94305.