Snf5p is similar to Sfh1p, Drosophila SNR1, Schizosaccharomyces pombe Snf5p, and Arabidopsis thaliana BSH, which can partially complement the defects seen in snf5 null mutants (42, 45, 46, 49). Snf5p also has a region of similarity to zebrafish SMARCB1 and Caenorhabditis elegans R07E5.3 (24). The human homolog of Snf5p (SMARCB1) is a tumor suppressor, mutation of which is associated with oncogenesis (24, 51). SMARCB1 binds to Epstein-Barr virus (EBV) nuclear protein 2 (EBNA2), which is expressed in latently-infected B lymphocytes and is essential to the immortalization of B cells by EBV (53). Human SMARCB1 also binds to human papillomavirus (HPV) E1 protein in two-hybrid assays and stimulates HPV DNA replication in vitro (55). By regulating the structure of chromatin, chromatin remodeling complexes, all of which contain an ATPase as a central motor subunit, perform critical functions in the maintenance, transmission, and expression of eukaryotic genomes. The SWI/SNF chromatin remodeling complex is involved in DNA replication, stress response, and transcription, and binds DNA nonspecifically, altering nucleosome structure to facilitate binding of transcription factors. For some genes, transcriptional activators are able to target the SWI/SNF complex to upstream activation sequences (UAS) in the promoter. The SWI/SNF chromatin remodeling complex family contains two evolutionary conserved subclasses of chromatin remodeling factors, one subfamily includes yeast SWI/SNF, fly BAP, and mammalian BAF, and the other subfamily includes yeast RSC (Remodel the Structure of Chromatin), fly PBAP, and mammalian PBAF (7, 9, 2, 12, 13, 8, 17, 6, 20, 22, 23, 26, 27, 30, 32, 33, 34, 36, 39, 40, 43, 44, 47, 48, 50, 39, 52, 54, 56, 57, 35). It appears that some human SWI/SNF subunits act as tumor suppressors and there is also evidence that human SWI/SNF subunits are involved in controlling cell growth via their interaction with other tumor suppressors (58). Expression of adenovirus E1A oncoproteins, which are regulators of cellular and viral transcription, in Saccharomyces cerevisiae requires the function of the SWI/SNF complex, and expression of E1A in wild-type cells leads to a specific loss of SWI/SNF dependent transcription. These results suggest that the SWI/SNF complex is a target of these oncoproteins in mammalian cells and that the disruption of normal cell cycle control by E1A may be due in part to altered activity of the SWI/SNF complex (59).", "date_edited": "2006-03-27"}, "literature_overview": {"primary_count": 91, "additional_count": 123, "review_count": 59, "go_count": 14, "phenotype_count": 12, "disease_count": 0, "interaction_count": 110, "regulation_count": 5, "ptm_count": 8, "funComplement_count": 0, "htp_count": 53, "total_count": 389}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 4, "target_count": 1, "paragraph": {"text": "SNF5 promoter is bound by Fkh1p; SNF5 promoter is bound by Xbp1p in response to heat; SNF5 transcription is regulated by Spt10p; SNF5 transcription is downregulated by Ixr1p in response to hypoxia", "date_edited": "2023-08-31", "references": [{"id": 371969, "display_name": "Ostrow AZ, et al. (2014)", "citation": "Ostrow AZ, et al. (2014) Fkh1 and Fkh2 bind multiple chromosomal elements in the S. cerevisiae genome with distinct specificities and cell cycle dynamics. PLoS One 9(2):e87647", "pubmed_id": 24504085, "link": "/reference/S000156933", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1371/journal.pone.0087647"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3913637/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24504085"}]}, {"id": 414327, "display_name": "Venters BJ, et al. (2011)", "citation": "Venters BJ, et al. (2011) A comprehensive genomic binding map of gene and chromatin regulatory proteins in Saccharomyces. Mol Cell 41(4):480-92", "pubmed_id": 21329885, "link": "/reference/S000145602", "year": 2011, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/j.molcel.2011.01.015"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057419/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/21329885"}]}, {"id": 524734, "display_name": "Mendiratta G, et al. (2006)", "citation": "Mendiratta G, et al. (2006) The DNA-binding domain of the yeast Spt10p activator includes a zinc finger that is homologous to foamy virus integrase. J Biol Chem 281(11):7040-8", "pubmed_id": 16415340, "link": "/reference/S000114259", "year": 2006, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1074/jbc.M511416200"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/16415340"}]}, {"id": 407966, "display_name": "Vizoso-V\u00e1zquez A, et al. (2012)", "citation": "Vizoso-V\u00e1zquez A, et al. (2012) Ixr1p and the control of the Saccharomyces cerevisiae hypoxic response. Appl Microbiol Biotechnol 94(1):173-84", "pubmed_id": 22189861, "link": "/reference/S000147832", "year": 2012, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/s00253-011-3785-2"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/22189861"}]}]}}, "reference_mapping": {"638930": 1, "636694": 2, "595387": 3, "617905": 4, "397497": 5, "616820": 6, "611245": 7, "600257": 8, "572435": 9, "553639": 10, "627050": 11, "591652": 12, "589270": 13, "622573": 14, "641072": 15, "646971": 16, "636210": 17, "628984": 18, "639439": 19, "615870": 20, "623641": 21, "635012": 22, "613366": 23, "586406": 24, "544367": 25, "619148": 26, "604412": 27, "531990": 28, "641962": 29, "593591": 30, "628236": 31, "584881": 32, "584872": 33, "580378": 34, "643583": 35, "547947": 36, "619652": 37, "631343": 38, "546954": 39, "546548": 40, "528249": 41, "614034": 42, "536087": 43, "529681": 44, "607071": 45, "601566": 46, "584878": 47, "584875": 48, "610689": 49, "584863": 50, "528240": 51, "639568": 52, "626727": 53, "584884": 54, "525675": 55, "636189": 56, "601809": 57, "556456": 58, "611554": 59, "599335": 60, "624823": 61, "601740": 62}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: HAF4", "date_created": "2010-02-16", "references": [{"id": 599335, "display_name": "Kuchin SV, et al. (1993)", "citation": "Kuchin SV, et al. (1993) Genes required for derepression of an extracellular glucoamylase gene, STA2, in the yeast Saccharomyces. Yeast 9(5):533-41", "pubmed_id": 8322516, "link": "/reference/S000056109", "year": 1993, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1002/yea.320090510"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/8322516"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SNF5", "date_created": "2000-05-19", "references": [{"id": 638930, "display_name": "Neigeborn L and Carlson M (1984)", "citation": "Neigeborn L and Carlson M (1984) Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae. Genetics 108(4):845-58", "pubmed_id": 6392017, "link": "/reference/S000042746", "year": 1984, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1093/genetics/108.4.845"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1224269/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/6392017"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SWI10", "date_created": "2010-02-16", "references": [{"id": 622573, "display_name": "Breeden L and Nasmyth K (1987)", "citation": "Breeden L and Nasmyth K (1987) Cell cycle control of the yeast HO gene: cis- and trans-acting regulators. Cell 48(3):389-97", "pubmed_id": 3542227, "link": "/reference/S000048261", "year": 1987, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/0092-8674(87)90190-5"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/3542227"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: TYE4", "date_created": "2010-02-16", "references": [{"id": 601740, "display_name": "Ciriacy M and Williamson VM (1981)", "citation": "Ciriacy M and Williamson VM (1981) Analysis of mutations affecting Ty-mediated gene expression in Saccharomyces cerevisiae. Mol Gen Genet 182(1):159-63", "pubmed_id": 6267430, "link": "/reference/S000055296", "year": 1981, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00422784"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/6267430"}]}, {"id": 624823, "display_name": "Ciriacy M, et al. (1991)", "citation": "Ciriacy M, et al. (1991) Characterization of trans-acting mutations affecting Ty and Ty-mediated transcription in Saccharomyces cerevisiae. Curr Genet 20(6):441-8", "pubmed_id": 1664298, "link": "/reference/S000047501", "year": 1991, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1007/BF00334769"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1664298"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Two nucleotide substitutions within the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.
Homology calls are sourced from the Alliance of Genome Resources. Many aspects of data integration presented at the Alliance require a common set of orthology relationships among genes for the organisms represented, including human. The Alliance provides the results of all methods that have been benchmarked by the Quest for Orthologs Consortium (QfO). The homolog inferences from the different methods have been integrated using the DRSC Integrative Ortholog Prediction Tool (DIOPT), which integrates a number of existing methods including those used by the Alliance: Ensembl Compara, HGNC, Hieranoid, InParanoid, OMA, OrthoFinder, OrthoInspector, PANTHER, PhylomeDB, Roundup, TreeFam, and ZFIN.
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
Information about cross-species functional complementation between yeast and other species, curated by SGD and the Princeton Protein Orthology Database (P-POD).
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
Fungal Homology calls are sourced from AllianceMine, which compiles fungal homology calls from FungiDB, CGD, Panther, PomBase, TreeFam, HomoloGene, and SGD.
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
List of external identifiers for the protein from various database sources.
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the
page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to
sort by that column; filter the table using the "Filter" box at the top of the table.
AGD |
AnalogYeast |
BLASTP at NCBI |
CGD |
FungiDB |
PhylomeDB |
PomBase |
YGOB |
YOGY
AlphaFold Protein Structure |
GPMDB |
ModelArchive |
Pfam domains |
SUPERFAMILY |
TopologYeast |
UniProtKB
CYCLoPs |
dHITS |
LoQAtE |
YeastGFP |
YeastRC Public Images |
YeastRGB |
YPL+
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi \r\nNew 780521 ACAACCTCCCACCAATGTTCAGCCAACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA 780580\r\n |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||\r\nOld 780517 ACAACCTCCCACCAATGTTCAGCCCACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA 780576\r\n\r\nNew 781311 GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGACATCTCTAATAGT 781370\r\n ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||\r\nOld 781307 GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGAGATCTCTAATAGT 781366", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-1150", "display_name": "SWI/SNF chromatin remodelling complex"}]};
SNF5 / YBR289W Homology
Homologs
HOMOLOG ID
Species
Gene ID
Gene name
Source
Functional Complementation
Complement ID
Locus ID
Gene
Species
Gene ID
Strain background
Direction
Details
Source
Reference
Fungal Homologs
HOMOLOG ID
Species
Gene ID
Gene name
Description
Source
External Identifiers
Alias ID
External ID
Source
Resources
Homologs
Protein Databases
Localization
Post-translational Modifications
S288C only
S288C vs. other species
S288C vs. other strains