\nNew: 106370 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGAACTTTGAACAGCCAATTGACCA 106429\n |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||\nOld: 106370 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGA-CTTTGAACAGCCAATTGACCA 106428\n\nNew: 106430 CCGCCTGGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTTT 106489\n |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||\nOld: 106429 CCGCCTCGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTTT 106488", "date_created": "2005-08-29", "references": []}, {"category": "Mapping", "history_type": "SEQUENCE", "note": "Mapping: Edition 14: The region corresponding to this gene is incorrect within the SCCHRIII GenBank entry (NID:g1907116), as of May 1998. The corrected region, which includes one insertion and one deletion, is included within SGD.", "date_created": "1997-10-20", "references": [{"id": 587084, "display_name": "Cherry JM, et al. (1997)", "citation": "Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73", "pubmed_id": 9169866, "link": "/reference/S000060841", "year": 1997, "urls": [{"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057085/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9169866"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Based on Brachat et al. 2003 and GenBank AY260880, the T at 105970 was deleted. This change resulted in a frameshift, moving the stop 267 bp downstream, and extending the protein from 296 aa to 385 aa. \r\nQuery: 918 AGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGGACGTCTATCTGTGCGT 860 \r\n ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| \r\nSbjct: 105931 AGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGGACGTCTATCTGTGCGT 105990", "date_created": "2004-02-19", "references": [{"id": 550654, "display_name": "Brachat S, et al. (2003)", "citation": "Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45", "pubmed_id": 12844361, "link": "/reference/S000073670", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1186/gb-2003-4-7-r45"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC193632/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12844361"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: One single nucleotide was deleted in Chromosome III in the intergenic region between ORFs YCL009C and YCL008C to correct the systematic sequence. The T at chromosomal coordinate 105580 was removed.\r\n\r\nOld: 105525 CGTCATCCACATGCGAAGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGG 105584\r\n ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||\r\nNew: 105531 CGTCATCCACATGCGAAGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGG 105589", "date_created": "2005-12-21", "references": []}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Several sequence changes were made to the systematic sequence in the region encompassing ORF YCL008C. The CC at chromosomal coordinate 105937 was changed to a G, the G at 105981 was changed to C, a C was inserted after the C at 106343, the A at 106402 was deleted, and a C was inserted after the T at 106429. Note that while the coordinates may appear to be different, the first four of these five changes are exact reciprocals of changes made on 1997-07-27, returning the systematic sequence to its original state in these areas. The insertion of the C after the T at 106429 is a novel change.\r\n\r\nOld: 105885 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTCCCTCCTG 105944\r\n |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||\r\nNew: 105890 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTG-CTCCTG 105948\r\n\r\nOld: 105945 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGGGCCTGATCTTGTGGCGGCTCGTG 106004\r\n |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||\r\nNew: 105949 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGCGCCTGATCTTGTGGCGGCTCGTG 106008\r\n\r\nOld: 106305 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTC-AGCAGCGCTAAAGAATCGTG 106363\r\n ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||\r\nNew: 106309 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTCCAGCAGCGCTAAAGAATCGTG 106368\r\n\r\nOld: 106364 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGAACTTTGAACAGCCAATTGACCA 106423\r\n |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||\r\nNew: 106369 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGA-CTTTGAACAGCCAATTGACCA 106427\r\n\r\nOld: 106424 CCGCCT-GGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTT 106482\r\n |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||\r\nNew: 106428 CCGCCTCGGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTT 106487", "date_created": "2005-12-21", "references": []}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: The systematic sequence was updated in the intergenic region between features YCL009C and YCL008C. Note that coordinates listed are chromosomal coordinates. This change is the exact reciprocal of the sequence change made on 1998-02-26.\r\n\r\nOld: 105548 GTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGGACGTCTATCTGTGCGTT 105606\r\n |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||\r\nNew: 105932 GTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGGACGTCTATCTGTGCGTT 105991", "date_created": "2005-12-29", "references": []}, {"category": "Annotation change", "history_type": "SEQUENCE", "note": "Annotation change: The start site of YCL008C was moved 252 nt upstream, and the stop site was moved 179 nt downstream, increasing the size of the coding region from 360 nt to 891 nt. The chromosomal coordinates have changed from 106208-105849 to 106849-105959.", "date_created": "2006-11-01", "references": []}, {"category": "Nomenclature history", "history_type": "LSP", "note": "Nomenclature history: In March 2014, the AGS1 locus was merged with STP22 and the AGS1 name became an alias name for STP22. The sequence of the ORF named AGS1 by Wickert et al. is entirely within the STP22 gene in the same reading frame. STP22 is known to mutate to the phenotype of the original ags1 mutation, aminoglycoside antibiotic sensitivity. Therefore AGS1 represents a fragment of STP22.", "date_created": "2014-03-11", "references": [{"id": 613177, "display_name": "Wickert S, et al. (1998)", "citation": "Wickert S, et al. (1998) A small protein (Ags1p) and the Pho80p-Pho85p kinase complex contribute to aminoglycoside antibiotic resistance of the yeast Saccharomyces cerevisiae. J Bacteriol 180(7):1887-94", "pubmed_id": 9537389, "link": "/reference/S000051435", "year": 1998, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1128/JB.180.7.1887-1894.1998"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC107104/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9537389"}]}]}], "complexes": [{"format_name": "CPX-940", "display_name": "ESCRT-I complex"}]},
tabs: {"id": 1268975, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
STP22 | SGD
STP22 / YCL008C Overview
- Standard Name
- STP22
1
- Systematic Name
- YCL008C
- SGD ID
- SGD:S000000514
- Aliases
-
AGS1
5
,
VPL15
6
,
VPS23
6
7
- Feature Type
- ORF
, Verified
- Description
-
Component of the ESCRT-I complex; ESCRT-I is involved in ubiquitin-dependent sorting of proteins into the endosome; prevents polyubiquitination of the arrestin-related protein Rim8p, thereby directing its monoubiquitination by Rsp5p; homologous to the mouse and human Tsg101 tumor susceptibility gene; mutants exhibit a Class E Vps phenotype;
2
3
4
- Name Description
- STerile Pseudoreversion
1
- Comparative Info
-
Sequence Details
Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
Analyze Sequence
S288C only
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
S288C vs. other strains
Protein Details
Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Summary
- Stp22p is 385 amino acids long, low in abundance; contains disordered region near middle of protein; phosphorylated on S186 and S316
- Length (a.a.)
- 385
- Mol. Weight (Da)
- 43315.7
- Isoelectric Point
- 5.48
- Median Abundance (molecules/cell)
- 1129 +/- 451
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
stp22-(vps23-F371D)
|
stp22-(vps23-L345D)
|
stp22-(vps23-L345D,M348D)
|
stp22-Δ
... Show all
Show fewer
View all STP22 alleles in SGD search
Gene Ontology Details
Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Ubiquitin-binding protein involved in reticulophagy, protein targeting, ATP export, and protein catabolism via MVB pathway; localizes to endosomes and cytoplasmic side of plasma membrane; subunit of ESCRT I complex
View computational annotations
Molecular Function
- Manually Curated
-
enables
ubiquitin binding
(IDA)
Biological Process
- Manually Curated
-
involved in
ATP export
(IMP)
-
involved in
late endosome to vacuole transport
(IMP)
-
involved in
negative regulation of protein polyubiquitination
(IMP)
-
involved in
protein targeting to membrane
(IMP)
-
involved in
protein targeting to vacuole
(IMP)
-
involved in
reticulophagy
(IDA)
Cellular Component
- Manually Curated
-
located in
cytoplasmic side of plasma membrane
(IDA)
-
located in
cytosol
(HDA)
-
located in
endosome
(IDA)
-
part of
ESCRT I complex
(IPI,
IDA)
Complex
Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.
Phenotype Details
Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
- Summary
- STP22/YCL008C is a non-essential gene; null mutants are viable but exhibit a range of phenotypic changes including decreased acquired thermotolerance, decreased biofilm formation, decreased duration of cell cycle progression in the G2 phase, increased chemical compound accumulation, decreased endocytosis, altered metal resistance, absent or decreased protein secretion, abnormal subcellular morphology, decreased toxin resistance, absent utilization of carbon sources, absent vacuolar transport, decreased acid pH resistance, abnormal colony appearance, altered competitive fitness, decreased desiccation resistance, increased heat sensitivity, decreased hyperosmotic stress resistance, decreased innate thermotolerance, decreased oxidative stress resistance, decreased respiratory growth rate, decreased RNA accumulation, decreased sporulation efficiency, decreased stress resistance, decreased telomere length, decreased transposable element transposition, decreased utilization rate of nitrogen sources, abnormal vacuolar morphology, and decreased vegetative growth rate. Repressible mutants show decreased vacuolar transport, while reduction of function mutants exhibit abnormal vacuolar transport. Overexpression of STP22 results in decreased resistance to chemicals, abnormal vacuolar morphology, and decreased vegetative growth rate.
Classical Genetics
- null
- acquired thermotolerance: decreased
- biofilm formation: decreased
- cell cycle progression in G2 phase: decreased duration
- chemical compound accumulation: increased
- endocytosis: decreased
- metal resistance: decreased
- metal resistance: increased
- protein secretion: absent
- protein secretion: decreased
- protein/peptide distribution: abnormal
- protein/peptide modification: abnormal
- protein/peptide modification: absent
- resistance to chemicals: decreased
- resistance to chemicals: increased
- subcellular morphology: abnormal
- toxin resistance: decreased
- utilization of carbon source: absent
- vacuolar transport: absent
- vacuolar transport: decreased
- reduction of function
- overexpression
- repressible
Large-scale Survey
- null
- acid pH resistance: decreased
- biofilm formation: decreased
- chemical compound accumulation: abnormal
- chemical compound accumulation: decreased
- chemical compound accumulation: increased
- chemical compound excretion: increased
- colony appearance: abnormal
- competitive fitness: decreased
- competitive fitness: increased
- desiccation resistance: decreased
- endocytosis: decreased
- haploproficient
- heat sensitivity: increased
- hyperosmotic stress resistance: decreased
- innate thermotolerance: decreased
- metal resistance: decreased
- metal resistance: increased
- oxidative stress resistance: decreased
- resistance to chemicals: decreased
- resistance to chemicals: increased
- respiratory growth: decreased rate
- RNA accumulation: decreased
- sporulation efficiency: decreased
- stress resistance: decreased
- telomere length: decreased
- toxin resistance: decreased
- transposable element transposition: decreased
- utilization of nitrogen source: decreased rate
- vacuolar morphology: abnormal
- vegetative growth: decreased
- vegetative growth: decreased rate
- viable
- overexpression
Interaction Details
Interaction
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
- Summary
- Stp22p interacts physically with proteins involved in transport; STP22 interacts genetically with genes involved in transcription
592 total interactions for 486 unique genes
Physical Interactions
- Affinity Capture-MS: 7
- Affinity Capture-RNA: 2
- Affinity Capture-Western: 16
- Biochemical Activity: 1
- Co-crystal Structure: 3
- Co-fractionation: 3
- Co-localization: 1
- Co-purification: 3
- PCA: 4
- Reconstituted Complex: 8
- Two-hybrid: 48
Genetic Interactions
- Dosage Lethality: 2
- Dosage Rescue: 2
- Negative Genetic: 252
- Phenotypic Enhancement: 7
- Phenotypic Suppression: 33
- Positive Genetic: 113
- Synthetic Growth Defect: 51
- Synthetic Haploinsufficiency: 1
- Synthetic Lethality: 22
- Synthetic Rescue: 13
Regulation Details
Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Regulators
-
4
- Targets
-
0
Expression Details
Expression
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
Summary Paragraph
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2025-01-27
Literature Details
Literature
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
Resources