Ty elements (transposon-yeast) are DNA sequences that move from one chromosomal site to another via an RNA intermediate (4). The DNA segment is transcribed into RNA, then reverse-transcribed into cDNA which is reinserted into the nuclear genome, usually at a different site. The original retrotransposon stays in place, and the new retrotransposon takes with it copies of any adjacent genes or regions that may have been duplicated during the process, making transposition a major source of gene expansion during genome evolution. The insertion event can also influence genomic evolution by disrupting coding or transcriptional control elements, or by promoting chromosomal rearrangements via homologous recombination (2).   There are approximately 50 retrotransposons in the yeast genome, comprising 5 types (Ty1 through Ty5), which represent two distinct groups of eukaryotic LTR-retrotransposons known as Ty1-copia (Pseudoviridae) and Ty3-gypsy (Metaviridae) elements. Ty1, Ty2, Ty4, and Ty5 are all Ty1-copia retrotransposons, whereas the Ty3 retrotransposons are the only representatives of the Ty3-gypsy group (2). Individual types can vary greatly in copy number and also in sequence, indicating different episodes of element amplification and subsequent divergence over time. Transposition is a nonrandom process, and insertion hotspots vary with Ty element type (7). Ty1, Ty2, Ty3 and Ty4 elements tend to integrate near tRNAs or other genes transcribed by RNA polymerase III (9, 10, 2), and Ty5 elements preferentially integrate into heterochromatin at telomeres and silent mating loci (11).   All five types of Ty elements share the same basic structure, consisting of TYA and TYB open reading frames (analogous to the retroviral gag and pol genes) flanked by long terminal repeats (LTRs) (2). TYA encodes structural proteins of the virus-like particle (VLP), where reverse transcription takes place. TYB encodes a polyprotein with protease (PR), integrase (IN), reverse transcriptase (RT) and ribonuclease H (RH) catalytic domains, all of which are essential for retrotransposition (1).   Ty elements are transcribed from their genomic DNA by the host cell's RNA polymerase II, producing RNAs that serve as both genomic RNA and mRNA. The mRNAs have caps and polyadenylated tails, and are translated on cytoplasmic ribosomes. After translation, the RNAs are packaged into virus-like particles (VLPs) in the cytoplasm and are reverse-transcribed by the self-encoded reverse transcriptase (RT) into double-stranded cDNAs (12). The replication cycle is completed by the movement of the cDNA back into the nucleus where it is inserted into new chromosomal sites by the retrotransposon-encoded integrase (5). About yeast LTRs...   There are 4 types of LTRs (Long Terminal Repeats) associated with Ty elements: delta (Ty1 and Ty2), sigma (Ty3), tau (Ty4), and omega (Ty5). These LTRs are present in the retrotransposons as flanking direct terminal repeats, and are also scattered about the genome as single LTRs, which have been abandoned through recombination between the two LTRs of a full-length Ty element (1). Delta sequences are by far the most abundant, at nearly 300, followed by sigma and tau at a few dozen each, and omega at less than 10. These distributions reflect the relative abundances of each of the types of Ty elements with which they are associated.   The flanking LTRs within a particular retrotransposon are identical in sequence and orientation, and contain the retrotransposon transcription initiation and termination signals. LTRs are composed of three sequence segments known as U3, R, and U5, which lie adjacent to each other in the 5' to 3' direction (5). The U3, R, and U5 regions are based on the sequences that appear in the RNA: U3 is unique to the 3' end of the RNA, R is repeated at the 5' and 3' ends of the RNA, and U5 is unique to the 5' end of the RNA (6). The transcription initiation site is at the junction of U3 and R in the 5' LTR, and the polyadenylation site is at the junction of R and U5 in the 3' LTR (5).   The majority of the Ty4 transcripts, in contrast to the other types, initiate at different sites within the 5' LTR, and terminate shortly upstream from the 3' LTR. These transcripts, therefore, lack the U3-R sequence generally required for strand transfer during DNA synthesis, resulting in the relatively low transpositional activity of Ty4 elements (8).", "date_edited": "2007-03-30"}, "literature_overview": {"primary_count": 6, "additional_count": 17, "review_count": 11, "go_count": 0, "phenotype_count": 0, "disease_count": 0, "interaction_count": 1, "regulation_count": 0, "ptm_count": 0, "funComplement_count": 0, "htp_count": 0, "total_count": 35}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 0, "target_count": 0}, "reference_mapping": {"529317": 1, "554212": 2, "525538": 3, "608404": 4, "504521": 5, "546378": 6, "622081": 7, "604964": 8, "648500": 9, "575385": 10, "572189": 11, "550713": 12}, "history": [{"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide insertion was made in the systematic sequence in the region encompassing overlapping features ARS300, YCLWTy5-1, and YCL076W.  A single C was inserted after the T at 1435.  This change resulted in the predicted protein encoded by YCL076W being elongated at the N-terminal end by 51 amino acids.  Note that coordinates listed are chromosomal coordinates.\r\n 
                The S. cerevisiae Reference Genome sequence is derived from laboratory strain
                S288C. Download DNA or protein sequence, view genomic context and
                coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
                for other strains.
             
                            BLASTN | 
                        
                            
                            Design Primers | 
                        
                            
                            Restriction Fragment Map | 
                        
                            
                            Restriction Fragment Sizes | 
                        
                            
                            Six-Frame Translation  
                A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
                to gene names and curated GO terms are included within the Summary Paragraphs.
             Last Updated: 2007-03-30 
                All manually curated literature for the specified gene, organized into topics according to their
                relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
                to view all literature information for this locus, including shared literature between genes.
            \r\nOld:    1434 CT-AGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1492\r\n             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||\r\nNew:    1441 CTCAGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1500", "date_created": "2005-12-22", "references": []}], "complexes": []},
        tabs: {"id": 1266502, "protein_tab": false, "interaction_tab": false, "summary_tab": true, "go_tab": false, "sequence_section": true, "expression_tab": false, "phenotype_tab": false, "literature_tab": true, "wiki_tab": false, "regulation_tab": false, "sequence_tab": true, "history_tab": false, "homology_tab": false, "disease_tab": false}
    };
	
	
	
    
    
	
    YCLWTy5-1
        
        
        
    Sequence
            
            
	
        Analyze Sequence
                    S288C only
S288C vs. other species
  
                        
                        
                    Summary Paragraph
            
            
        Literature
            
            
        
    Resources