See More

Loss of Ydj1p function results in defective mating, alpha-factor secretion, and inability to properly fold a heterologously expressed human androgen receptor protein (21, 22). Null mutations in ydj1 lead to a slow growth phenotype at 25 degrees C on solid media, and lethality in cells grown at 37 degrees C or in liquid culture (22, 1). This temperature-sensitive phenotype can be complemented by heterologous expression of either plant ANJ1, trypanosome TCJ2, or rat RDJ1 (23, 24, 25). YDJ1 overexpression has been studied in yeast models of human prion disease such as Creutzfeldt-Jakob disease (OMIM) and has been found to cure cells propagating the [PSI+] and [URE3] prions (isoforms of Sup35p and Ure2p, respectively) (26, 27, 28).

Comparative, mutational, and crystal structure analyses show that Ydj1p contains all of the structurally defined domains found in bacterial DnaJ, human Hdj2 (OMIM) and other type I Hsp40 proteins: an amino-terminal J domain linked by a glycine and phenylalanine-rich region to a zinc finger-like region (ZFLR) followed by a conserved carboxyl-terminal domain (1, 17, 22, 29, 15). Like other type I and type II Hsp40s, Ydj1p functions as a homodimer with protein dimerization being mediated by the Ydj1p C-terminus (30). The Ydj1p ZFLR has been shown to be required for substrate transfer to Hsp70 (22). Ydj1p is also a target for farnesylation, a modification that is necessary for the protein to function at elevated temperatures (31).", "date_edited": "2006-12-19"}, "literature_overview": {"primary_count": 189, "additional_count": 178, "review_count": 101, "go_count": 15, "phenotype_count": 21, "disease_count": 1, "interaction_count": 214, "regulation_count": 7, "ptm_count": 13, "funComplement_count": 3, "htp_count": 65, "total_count": 660}, "disease_overview": {"manual_disease_terms": [{"annotation_type": "manually curated", "qualifiers": [null], "term": {"link": "/disease/DOID:10652", "display_name": "Alzheimer's disease"}, "evidence_codes": [{"display_name": "ISS", "link": "http://wiki.geneontology.org/index.php/Inferred_from_Sequence_or_structural_Similarity_(ISS)"}, {"display_name": "IGI", "link": "http://wiki.geneontology.org/index.php/Inferred_from_Genetic_Interaction_(IGI)"}]}], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": "2023-06-26", "paragraph": "Yeast YDJ1 is homologous to human DNAJA1, and has been used to study amyloid beta 42 toxicity as the principal trigger of neurodegeneration during Alzheimer's disease (AD); DNAJA1 has been found to be dysregulated in post mortem brains of AD patients"}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 10, "target_count": 0}, "reference_mapping": {"613733": 1, "621472": 2, "598102": 3, "619253": 4, "564584": 5, "471556": 6, "397734": 7, "356480": 8, "562553": 9, "2658256": 10, "631064": 11, "513495": 12, "601887": 13, "632880": 14, "542872": 15, "573455": 16, "605961": 17, "628426": 18, "622588": 19, "636875": 20, "622520": 21, "530386": 22, "626303": 23, "540981": 24, "514055": 25, "561066": 26, "524476": 27, "590648": 28, "510053": 29, "533930": 30, "618089": 31, "616784": 32, "552957": 33}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: HSP40", "date_created": "2010-02-16", "references": []}, {"category": "Name", "history_type": "LSP", "note": "Name: MAB3", "date_created": "2014-04-25", "references": [{"id": 552957, "display_name": "Tomita Y, et al. (2003)", "citation": "Tomita Y, et al. (2003) Mutation of host DnaJ homolog inhibits brome mosaic virus negative-strand RNA synthesis. J Virol 77(5):2990-7", "pubmed_id": 12584324, "link": "/reference/S000068822", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1128/jvi.77.5.2990-2997.2003"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC149758/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12584324"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: MAS5", "date_created": "2010-02-16", "references": [{"id": 616784, "display_name": "Atencio DP and Yaffe MP (1992)", "citation": "Atencio DP and Yaffe MP (1992) MAS5, a yeast homolog of DnaJ involved in mitochondrial protein import. Mol Cell Biol 12(1):283-91", "pubmed_id": 1729605, "link": "/reference/S000050215", "year": 1992, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1128/mcb.12.1.283-291.1992"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC364104/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1729605"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: YDJ1", "date_created": "2000-05-19", "references": [{"id": 613733, "display_name": "Caplan AJ and Douglas MG (1991)", "citation": "Caplan AJ and Douglas MG (1991) Characterization of YDJ1: a yeast homologue of the bacterial dnaJ protein. J Cell Biol 114(4):609-21", "pubmed_id": 1869583, "link": "/reference/S000051244", "year": 1991, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1083/jcb.114.4.609"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2289889/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/1869583"}]}]}, {"category": "Nomenclature history", "history_type": "LSP", "note": "Nomenclature history: The MAB3 genetic locus was previously a \"Not Physically Mapped\" feature in SGD. However, PMID: 12584324 states that MAB3 is allelic to YDJ1. MAB3 was merged with YDJ1 in April 2014.", "date_created": "2014-04-25", "references": [{"id": 552957, "display_name": "Tomita Y, et al. (2003)", "citation": "Tomita Y, et al. (2003) Mutation of host DnaJ homolog inhibits brome mosaic virus negative-strand RNA synthesis. J Virol 77(5):2990-7", "pubmed_id": 12584324, "link": "/reference/S000068822", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1128/jvi.77.5.2990-2997.2003"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC149758/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12584324"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: The work of Kellis et al. proposed an indel that would shorten the YNL065W reading frame. Sequencing of S288C by SGD confirmed the current sequence for YNL065W, but an error in the intergenic region between YNL065W and YNL064C was identified. This insertion does not affect any coding features.

New:        ATTAATTGGCATTCTTCAATTTGATAGACACTTATCCCTGCATATTTTTTTTATAAACAG
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old: 505479 ATTAATTGGCATTCTTCAATTTGATAGACACTTATCC-TGCATATTTTTTTTATAAACAG 505537", "date_created": "2004-07-22", "references": [{"id": 551672, "display_name": "Kellis M, et al. (2003)", "citation": "Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54", "pubmed_id": 12748633, "link": "/reference/S000073327", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1038/nature01644"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12748633"}, {"display_name": "Reference supplement", "link": "http://www.nature.com/nature/journal/v423/n6937/suppinfo/nature01644.html"}]}]}], "complexes": [{"format_name": "CPX-1882", "display_name": "HAP1 transcriptional repressor complex, SSA1 variant"}, {"format_name": "CPX-1883", "display_name": "HAP1 transcriptional repressor complex, SSA2 variant"}, {"format_name": "CPX-1276", "display_name": "HMC complex"}]}, tabs: {"id": 1286865, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": true} }; YDJ1 | SGD

YDJ1 / YNL064C Overview


Standard Name
YDJ1 1
Systematic Name
YNL064C
SGD ID
SGD:S000005008
Aliases
MAS5 32 , HSP40 , MAB3 33
Feature Type
ORF , Verified
Description
Type I HSP40 co-chaperone; regulates HSP90 and HSP70 functions; acts as an adaptor that helps Rsp5p recognize and ubiquitinate misfolded, cytosolic proteins after heat shock; critical for determining cell size at Start as a function of growth rate; involved in protein translocation across membranes; forms cytotoxic amyloidogenic-like structures in vitro; DnaJ family member; chimeric protein in which the human p58IPK J domain replaces the yeast Ydj1p J domain can complement yeast ydj1 mutant 1 2 3 4 5 6 7 8 9 10
Name Description
Yeast dnaJ 1
Comparative Info
Sequence Details

Sequence

The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.


Protein Details

Protein

Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.


Summary
Ydj1p is 409 amino acids long; acetylated on 12 residues; N-terminal acetylation of the J domain fine-tunes translational fidelity and client protein refolding
Length (a.a.)
409
Mol. Weight (Da)
44666.2
Isoelectric Point
6.21
Median Abundance (molecules/cell)
41251 +/- 16052
Half-life (hr)
11.4

Alleles

Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.


View all YDJ1 alleles in SGD search

Gene Ontology Details

Gene Ontology

GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.


Summary
ATPase-activating protein chaperone involved in 'de novo' protein folding, refolding and catabolism; subunit of the TMD recognition ER membrane insertion complex; localizes to the cytoplasm near the nucleus

View computational annotations

Molecular Function

Manually Curated

Biological Process

Manually Curated

Cellular Component

Manually Curated

Complex

Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.


Phenotype Details

Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.


Summary
Non-essential gene in reference strain S288C; null mutant exhibits slow growth, decreased fitness and lifespan, abnormal colony shape and vacuolar morphology, increased sensitivity to heat, oxidative stress, metals, caffeine, cardivascular drug amiodarone, phosphatidylinositol 3-kinase inhibitor wortmannin, Hsp90 inhibitor tanespimycin, TOR inhibitor rapamycin, antioxidant spermine, reducing agent L-1,4-dithiothreitol, microtubule-destabilising agent benomyl, protein synthesis inbibitor cycloheximide, herbicide amitrole, allergen glyoxal, and various alcohols, antibiotics, antifungals, and mutagens; homozygous diploid null mutant displays increased resistance to carcinogen benzo[a]pyrene, and is sensitive to zinc, sorbate, mycotoxin Trichothecin; overexpression confers resistance to TOR inhibitor rapamycin and causes increased invasive growth and prion loss
Disease Details

Disease

Disease Annotations consist of three mandatory components: a gene product, a term from the Disease Ontology (DO) controlled vocabulary and an evidence code. SGD provides manually curated DO Annotations derived from the literature. Click "Disease Details" to view all Disease information and evidence for this locus as well as diseases it shares with other genes.


Summary
Yeast YDJ1 is homologous to human DNAJA1, and has been used to study amyloid beta 42 toxicity as the principal trigger of neurodegeneration during Alzheimer's disease (AD); DNAJA1 has been found to be dysregulated in post mortem brains of AD patients

Manually Curated

Interaction Details

Interaction

Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.


1461 total interactions for 979 unique genes

Physical Interactions

  • Affinity Capture-MS: 160
  • Affinity Capture-RNA: 10
  • Affinity Capture-Western: 40
  • Biochemical Activity: 7
  • Co-crystal Structure: 2
  • Co-fractionation: 1
  • Co-localization: 1
  • Co-purification: 4
  • Cross-Linking-MS (XL-MS): 2
  • PCA: 1
  • Proximity Label-MS: 3
  • Reconstituted Complex: 26
  • Two-hybrid: 1

Genetic Interactions

  • Dosage Growth Defect: 8
  • Dosage Rescue: 20
  • Negative Genetic: 886
  • Phenotypic Enhancement: 8
  • Phenotypic Suppression: 5
  • Positive Genetic: 197
  • Synthetic Growth Defect: 28
  • Synthetic Lethality: 44
  • Synthetic Rescue: 7
Regulation Details

Regulation

The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.


Regulators
10
Targets
0
Expression Details

Expression

Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.


Summary Paragraph

A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links to gene names and curated GO terms are included within the Summary Paragraphs.


Last Updated: 2006-12-19

Literature Details

Literature

All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.


Primary
189
Additional
178
Reviews
101

Resources


© Stanford University, Stanford, CA 94305.