Ribosomes are highly conserved large ribonucleoprotein (RNP) particles, consisting in yeast of a large 60S subunit and a small 40S subunit, that perform protein synthesis. Yeast ribosomes contain one copy each of four ribosomal RNAs (5S, 5.8S, 18S, and 25S; produced in two separate transcripts encoded within the rDNA repeat present as hundreds of copies on Chromosome 12) and 79 different ribosomal proteins (r-proteins), which are encoded by 137 different genes scattered about the genome, 59 of which are duplicated (7, 6). The 60S subunit contains 46 proteins and three RNA molecules: 25S RNA of 3392 nt, hydrogen bonded to the 5.8S RNA of 158 nt and associated with the 5S RNA of 121 nt. The 40S subunit has a single 18S RNA of 1798 nt and 33 proteins (8, 6). All yeast ribosomal proteins have a mammalian homolog (9).   In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to the production of mRNAs for r-proteins. Coordinate regulation of the rRNA genes and 137 r-protein genes is affected by nutritional cues and a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, whose transcripts have naturally short lifetimes, leading to major implications for the expression of other genes as well (10, 11, 12). The expression of some r-protein genes is influenced by Abf1p (13), and most are directly induced by binding of Rap1p to their promoters, which excludes nucleosomes and recruits Fhl1p and Ifh1p to drive transcription (14).   Ribosome assembly is a complex process, with different steps occurring in different parts of the cell. Ribosomal protein genes are transcribed in the nucleus, and the mRNA is transported to the cytoplasm for translation. The newly synthesized r-proteins then enter the nucleus and associate in the nucleolus with the two rRNA transcripts, one of which is methylated and pseudouridylated ( 
                The S. cerevisiae Reference Genome sequence is derived from laboratory strain
                S288C. Download DNA or protein sequence, view genomic context and
                coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
                for other strains.
             
                            BLASTN | 
                        
                            
                            BLASTP | 
                        
                            
                            Design Primers | 
                        
                            
                            Restriction Fragment Map | 
                        
                            
                            Restriction Fragment Sizes | 
                        
                            
                            Six-Frame Translation  
                            BLASTN vs. fungi | 
                        
                            
                            BLASTP at NCBI | 
                        
                            
                            BLASTP vs. fungi  
       	       Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
             
		Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.                     
                 View all RPL6B alleles in SGD search
 
                GO Annotations consist of four mandatory components: a gene product, a term from one of the three
                Gene Ontology (GO) controlled vocabularies
                (Molecular Function,
                Biological Process, and
                Cellular Component), a reference, and an
                evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
                literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
                all GO information and evidence for this locus as well as biological processes it shares with other genes.
             View computational annotations 
                Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
                (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
                and a reference. In addition, annotations are classified as classical genetics or high-throughput
                (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
                additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
                evidence for this locus as well as phenotypes it shares with other genes.
             
                Interaction annotations are curated by BioGRID and include physical
                or genetic interactions observed
                between at least two genes. An interaction annotation is composed of the interaction type, name of the
                interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
                reference, as well as other experimental details. Click "Interaction Details" to view all interaction
                annotations and evidence for this locus, including an interaction visualization.
             526 total interactions for 467 unique genes 
                The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
                given locus, based on experimental evidence. This evidence includes data generated through
                high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
                enrichment among regulation Targets, and a regulator/target diagram for the locus.
             
                Expression data are derived from records contained in the
                Gene Expression Omnibus (GEO), and are first log2
                transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
                there may be a greater number of conditions than datasets represented in a single clickable histogram
                bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
                those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
                details for this locus, including a visualization of genes that share a similar expression pattern.
             
                A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
                to gene names and curated GO terms are included within the Summary Paragraphs.
             Last Updated: 2007-02-14 
                All manually curated literature for the specified gene, organized into topics according to their
                relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
                to view all literature information for this locus, including shared literature between genes.
            \r\nNew    1028577  TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTAGGCTGCGCTTCCGTTCAGCATCGTTT  1028636\r\n                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||\r\nOld    1028574  TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTA-GCTGCGCTTCCGTTCAGCATCGTTT  1028632", "date_created": "2011-02-16", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
        tabs: {"id": 1286667, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
    };
	
	
	
    
    
	
    RPL6B / YLR448W Overview
        
        
        
                
                
                    
 
                       
                    
		       
			    
		       
                    
		       
			    
		       
                    
		       
			    
		       
                    
		       
                            
		       
                    
		       
			    
		       
                    
		       
		            
		       
                    
                Sequence
            
            
	
        
                    
Analyze Sequence
                    S288C only
S288C vs. other species
 S288C vs. other strains
 
                        
                    Protein
            
            
	
                     
Alleles
                
                
	
Gene Ontology
            
            
        
                    
Molecular Function
                    
                        
                        
                            
                                
Biological Process
                    
                        
                        
                            
                                
Cellular Component
                    
                        
                        
                            
                                
Phenotype
            
            
        
        Classical Genetics
                    
                
                        
Large-scale Survey
                        
                            
                                
                                     
Interaction
            
            
        
                    
Physical Interactions
                    
                        
                            
Genetic Interactions
                    
                        
                            
Regulation
            
            
	
        
                         
Expression
            
            
        Summary Paragraph
            
            
        Literature
            
            
        
    Resources