See More

Sec61p is widely conserved; the mammalian ortholog, Sec61alpha, and the archael ortholog SecY have been extensively studied and the mechanism of translocation is thought to be conserved among all species (reviewed in 27 and 28).", "date_edited": "2007-10-02"}, "literature_overview": {"primary_count": 106, "additional_count": 139, "review_count": 73, "go_count": 14, "phenotype_count": 9, "disease_count": 0, "interaction_count": 109, "regulation_count": 4, "ptm_count": 2, "funComplement_count": 0, "htp_count": 16, "total_count": 385}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 9, "target_count": 0}, "reference_mapping": {"623094": 1, "595867": 2, "544089": 3, "633895": 4, "589065": 5, "390488": 6, "375826": 7, "2210553": 8, "528630": 9, "643478": 10, "626454": 11, "496096": 12, "591385": 13, "500955": 14, "646059": 15, "632828": 16, "608303": 17, "645674": 18, "643499": 19, "535305": 20, "610912": 21, "497647": 22, "572159": 23, "498375": 24, "600518": 25, "647247": 26, "621936": 27, "496089": 28}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: SEC61", "date_created": "2000-05-19", "references": [{"id": 623094, "display_name": "Deshaies RJ and Schekman R (1987)", "citation": "Deshaies RJ and Schekman R (1987) A yeast mutant defective at an early stage in import of secretory protein precursors into the endoplasmic reticulum. J Cell Biol 105(2):633-45", "pubmed_id": 3305520, "link": "/reference/S000048086", "year": 1987, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1083/jcb.105.2.633"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2114772/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/3305520"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide deletion was made in the intergenic region between ORFs SEC61/YLR378C and CSR1/YLR380W.\r\n

\r\nNew    878158   AAATCTTGGCACTT-GTCACTTACGCTCCTTTAAACAAAATCAAACATACAAATATACGG  878216\r\n                |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||\r\nOld    878157   AAATCTTGGCACTTGGTCACTTACGCTCCTTTAAACAAAATCAAACATACAAATATACGG  878216", "date_created": "2011-02-16", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-1833", "display_name": "SEC61 protein-conducting channel complex"}, {"format_name": "CPX-3055", "display_name": "Translocon complex"}]},
        tabs: {"id": 1284213, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
    };


	
	
	
    
    
	
    SEC61 | SGD
    
	
	
	









	
	

SEC61 / YLR378C Overview


Standard Name
SEC61 1
Systematic Name
YLR378C
SGD ID
SGD:S000004370
Feature Type
ORF , Verified
Description
Conserved ER protein translocation channel; essential subunit of Sec61 complex (Sec61p, Sbh1p, and Sss1p); forms channel for SRP-dependent protein import; with Sec63 complex is required for SRP-independent protein translocation into the ER; involved in posttranslational soluble protein import into the ER, ERAD of soluble substrates, and misfolded soluble protein export from the ER 3 4 5 6 7 8
Name Description
SECretory 2
Comparative Info
Sequence Details

Sequence

The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.


Protein Details

Protein

Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.


Length (a.a.)
480
Mol. Weight (Da)
52947.9
Isoelectric Point
9.74
Median Abundance (molecules/cell)
17267 +/- 13239
Half-life (hr)
19.1

Alleles

Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.


Sec61-Y345H | sec61-2 | sec61-3 | sec61-32 | sec61-41 | sec61-D168A | sec61-D61N | ... Show all

View all SEC61 alleles in SGD search

Gene Ontology Details

Gene Ontology

GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.


Summary
Subunit of the Sec61 translocon complex involved in the co-translational import of proteins into the endoplasmic reticulum (ER); also involved in retrograde protein transport and ER-associated protein degradation

View computational annotations

Cellular Component

Manually Curated

Complex

Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.


Phenotype Details

Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.


Summary
Essential gene in reference strain S288C; reduction-of-function mutations confer slow growth and defects in intracellular protein traffic
Interaction Details

Interaction

Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.


3032 total interactions for 2480 unique genes

Physical Interactions

  • Affinity Capture-MS: 392
  • Affinity Capture-RNA: 5
  • Affinity Capture-Western: 25
  • Co-fractionation: 13
  • Co-localization: 1953
  • Co-purification: 13
  • Cross-Linking-MS (XL-MS): 1
  • PCA: 34
  • Reconstituted Complex: 5
  • Two-hybrid: 2

Genetic Interactions

  • Dosage Lethality: 1
  • Dosage Rescue: 9
  • Negative Genetic: 433
  • Phenotypic Enhancement: 10
  • Phenotypic Suppression: 10
  • Positive Genetic: 104
  • Synthetic Growth Defect: 6
  • Synthetic Lethality: 3
  • Synthetic Rescue: 13
Regulation Details

Regulation

The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.


Regulators
9
Targets
0
Expression Details

Expression

Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.


Summary Paragraph

A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links to gene names and curated GO terms are included within the Summary Paragraphs.


Last Updated: 2007-10-02

Literature Details

Literature

All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.


Primary
106
Additional
139
Reviews
73

Resources


© Stanford University, Stanford, CA 94305.