\r\nNew 397840 AAAAAAAAAAAAAAATAAATGA-CACATGGAAATAAGTCAAGGATTAGCGGATATGTAGT 397898\r\n |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||\r\nOld 397846 AAAAAAAAAAAAAAATAAATGAACACATGGAAATAAGTCAAGGATTAGCGGATATGTAGT 397905\r\n\r\nNew 397959 CTAATCATTATGCACGTCAAGATTCTCCGTGACTATGGCTCTTTTCTGAAGCATTTTTCG 398018\r\n ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||\r\nOld 397966 CTAATCATTATGCACGTCAAGATTCTCCGTGACTATGGCTCTTTTCTGA-GCATTTTTCG 398024\r\n\r\nNew 398019 GG-CGCCCGGTGGCCAAAAACTAACTCCGAGCCCGGGCATGTCCCGGGGTTAGCGGGCCC 398077\r\n || |||||| || |||||||||||||||||||||||||||||||||| |||||||||||\r\nOld 398025 GGGCGCCCG-TG--CAAAAACTAACTCCGAGCCCGGGCATGTCCCGGG-TTAGCGGGCCC 398080", "date_created": "2011-04-13", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []}, tabs: {"id": 1282772, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false} };OLE1 | SGD OLE1 / YGL055W Overview
- Standard Name
- OLE1 1 2
- Systematic Name
- YGL055W
- SGD ID
- SGD:S000003023
- Aliases
- MDM2 4
- Feature Type
- ORF , Verified
- Description
- Delta(9) fatty acid desaturase; required for monounsaturated fatty acid synthesis and for normal distribution of mitochondria 3 4
- Name Description
- OLEic acid requiring 2
- Comparative Info
Sequence Details Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.
Analyze Sequence
S288C only
BLASTN | BLASTP | Design Primers | Restriction Fragment Map | Restriction Fragment Sizes | Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi | BLASTP at NCBI | BLASTP vs. fungi
S288C vs. other strains
Protein Details Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Summary
- Ole1p is 510 amino acids long, shorter-lived, low in abundance; acetylated on K350, ubiquitinylated on 7 lysines, phosphorylated on 9 residues
- Length (a.a.)
- 510
- Mol. Weight (Da)
- 58412.6
- Isoelectric Point
- 9.33
- Median Abundance (molecules/cell)
- 9355 +/- 3317
- Half-life (hr)
- 6.5
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
ole1-(mdm2-2) | ole1-D242G | ole1-F417S | ole1-S221F | ole1-m2 | ole1-mdm2 | ole1-Δ ... Show all Show fewerView all OLE1 alleles in SGD search
Gene Ontology Details Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Stearoyl-CoA 9-desaturase involved in unsaturated fatty acid biosynthesis and mitochondrion inheritance; localizes to endoplasmic reticulum
View computational annotations
Molecular Function
- Manually Curated
- enables electron transfer activity (IGI, ISA)
- enables stearoyl-CoA 9-desaturase activity (IMP)
Biological Process
- Manually Curated
- involved in mitochondrion inheritance (IMP)
- involved in unsaturated fatty acid biosynthetic process (IMP)
Cellular Component
- Manually Curated
- located in endoplasmic reticulum (HDA)
- located in endoplasmic reticulum membrane (IDA)
Pathways
Phenotype Details Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.
- Summary
- OLE1/YGL055W is an essential gene; null mutant is viable with oleic acid supplementation; heat-sensitive mutant requires oleic acid at restrictive temperature but displays abnormal distribution of mitochondria even at permissive temperature; overexpression confers increased resistance to ethanol, increased invasive growth
Classical Genetics
- overexpression
- reduction of function
- null
- conditional
- auxotrophy
- cellular morphology: abnormal
- chemical compound accumulation: decreased
- chemical compound accumulation: increased
- heat sensitivity: increased
- mitochondrial distribution: abnormal
- mitochondrial morphology: abnormal
- nuclear morphology: abnormal
- resistance to chemicals: decreased
- RNA accumulation: increased
- spindle morphology: abnormal
Large-scale Survey
- null
- reduction of function
- overexpression
- conditional
Interaction Details Interaction
Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.
- Summary
- Ole1p interacts physically with proteins involved in lipid metabolism; OLE1 interacts genetically with genes involved in lipid metabolism
325 total interactions for 246 unique genes
Physical Interactions
- Affinity Capture-MS: 55
- Affinity Capture-RNA: 8
- Affinity Capture-Western: 2
- Biochemical Activity: 3
- Co-localization: 1
- Cross-Linking-MS (XL-MS): 1
- PCA: 21
- Protein-RNA: 1
- Proximity Label-MS: 1
- Two-hybrid: 2
Genetic Interactions
- Dosage Growth Defect: 1
- Dosage Rescue: 13
- Negative Genetic: 177
- Phenotypic Enhancement: 1
- Phenotypic Suppression: 4
- Positive Genetic: 21
- Synthetic Growth Defect: 10
- Synthetic Lethality: 3
Regulation Details Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Summary
- OLE1/YGL055W promoter is bound by Fkh1p, Rfx1p, Tfc7p, and Xbp1p in response to heat; OLE1 transcription is downregulated by Nab3p; OLE1 transcription is regulated by Sfp1p in response to stress; OLE1 transcription is upregulated by Yap5p in response to iron and by Mga2p in response to iron starvation, and downregulated by Ixr1p in response to hypoxia and by Znf1p during xylose fermentation
- Regulators
- 19
- Targets
- 0
Expression Details Expression
Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.
Summary Paragraph
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2010-05-10
Literature Details Literature
All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.
Resources