Autophagy proceeds via a multistep pathway. First, nutrient availability is sensed by the TORC1 complex and also cooperatively by protein kinase A and Sch9p (26, 28). Second, signals generated by the sensors are transmitted to the autophagosome-generating machinery comprised of the 17 Atg gene products. These 17 proteins collectively form the pre-autophagosomal structure/phagophore assembly site (PAS). The PAS generates an isolation membrane (IM), which expands and eventually fuses along the edges to complete autophagosome formation. At the vacuole the outer membrane of the autophagosome fuses with the vacuolar membrane and autophagic bodies are released, disintegrated, and their contents degraded for reuse in biosynthesis (30 and reviewed in 23). Cytoplasm-to-vacuole targeting (Cvt) is a constitutive and specific form of autophagy that uses autophagosomal-like vesicles for selective transport of hydrolases aminopeptidase I (Lap4p) and alpha-mannosidase (Ams1p) to the vacuole (12, 17). Unlike autophagy, which is primarily a catabolic process, Cvt is a biosynthetic process. Like autophagosomes, Cvt vesicles form at a structure known as the phagophore assembly site (PAS) (also called the pre-autophagosomal structure). The PAS structure generates an isolation membrane (IM), which expands and eventually fuses along the edges to complete vesicle formation. At the vacuole, the outer membrane of the Cvt vesicle fuses with the vacuolar membrane, the vesicle is degraded, and the cargos are released and processed into their mature forms by vacuolar peptidases (reviewed in 21). The Cvt pathway has not been observed outside of yeast, and enzymes specifically involved in this pathway are not well conserved in other organisms (15 and references therein).about ATG18 ATG18 and ATG21 are paralogous genes that, along with HSV2, encode members of a vacuolar/perivacuolar family of phosphoinositide binding proteins (14, 18, 4, 8). Atg18p is essential for vesicle formation in both autophagy and the Cvt pathway (4, 2). Atg21p is only required for vesicle formation in the Cvt pathway (24) but may have some role in autophagic fidelity (25). Atg18p and Atg21p are WD-40 repeat proteins, expected to fold as seven bladed β-propellers, that are able to bind both phosphatidylinositol (3,5)-bisphosphate (PtdIns(3,5)P2) and phosphatidylinositol 3-phosphate (PtdIns3P) (4, 8). Atg18p localizes to both the preautophagosomal structure (PAS) and to punctate structures at the vacuolar membrane (3, 18, 2). Localization to these two structures may involve a mechanism that depends on differential phosphatidylinositide binding: PtdIns3P to the PAS and PtdIns(3,5)P2 to the vacuolar membrane (8, 4). Vacuolar localization of Atg18p is also dependent on the transmembrane protein Vac7p (27). PAS-localized Atg18p is involved in localization of the autophagy proteins Atg2p and Atg9p (18, 3). Vacuolar Atg18p is required for retrograde trafficking from the vacuole to the late endosome (4) as well as regulating the activity of the phosphatidylinositol(3)-phosphate 5-kinase Fab1p which affects PtdIns(3,5)P2 levels and vacuolar morphology (27). atg18 null strains have enlarged vacuoles and high levels of PtdIns(3,5)P2; they are unable to sporulate and unable to grow on media containing glycerol as the sole carbon source (4, 2, 14). Atg18p and Atg21p have also been shown to interact with the transcriptional activator Rtg3p and null atg18 or atg21 mutations result in the reduced expression of RTG-regulated genes (14). WD-repeat proteins are conserved from yeast to man, and ATG18 homologs have been identified in organisms such as Drosophila (CG11975) and human (WDR45L/WIPI3) (29, 4). Aberrant expression of human WIPI genes has been found in various cancerous tissues (4).about autophagy nomenclature The initial identification of factors involved in autophagy was carried out by several independent labs, which led to a proliferation of nomenclature for the genes and gene products involved. The differing gene name acronyms from these groups included APG, AUT, CVT, GSA, PAG, PAZ, and PDD (1 and references therein). A concerted effort was made in 2003 by the scientists working in the field to unify the nomenclature for these genes, and \"AuTophaGy-related\" genes are now denoted by the letters ATG (1). In addition to the ATG gene names that have been assigned to S. cerevisiae proteins and their orthologs, several ATG gene names, including ATG25, ATG28, and ATG30, have been used to designate proteins in other ascomycete yeast species for which there is no identifiable equivalent in S. cerevisiae (15, 20).", "date_edited": "2008-04-25"}, "literature_overview": {"primary_count": 73, "additional_count": 52, "review_count": 110, "go_count": 17, "phenotype_count": 20, "disease_count": 0, "interaction_count": 51, "regulation_count": 3, "ptm_count": 5, "funComplement_count": 0, "htp_count": 27, "total_count": 293}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 4, "target_count": 0}, "reference_mapping": {"549294": 1, "572027": 2, "545890": 3, "543733": 4, "390008": 5, "398398": 6, "382442": 7, "533900": 8, "1924729": 9, "2580706": 10, "2729057": 11, "594256": 12, "504318": 13, "573010": 14, "509070": 15, "629040": 16, "529067": 17, "562192": 18, "627092": 19, "489236": 20, "556282": 21, "509073": 22, "503381": 23, "562824": 24, "536369": 25, "497654": 26, "497657": 27, "584833": 28, "536384": 29, "564292": 30, "586676": 31}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: ATG18", "date_created": "2001-03-26", "references": [{"id": 549294, "display_name": "Klionsky DJ, et al. (2003)", "citation": "Klionsky DJ, et al. (2003) A unified nomenclature for yeast autophagy-related genes. Dev Cell 5(4):539-45", "pubmed_id": 14536056, "link": "/reference/S000074141", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/s1534-5807(03)00296-x"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/14536056"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: AUT10", "date_created": "2010-02-16", "references": [{"id": 572027, "display_name": "Barth H, et al. (2001)", "citation": "Barth H, et al. (2001) Autophagy and the cytoplasm to vacuole targeting pathway both require Aut10p. FEBS Lett 508(1):23-8", "pubmed_id": 11707261, "link": "/reference/S000066204", "year": 2001, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/s0014-5793(01)03016-2"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11707261"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: CVT18", "date_created": "2010-02-16", "references": [{"id": 562192, "display_name": "Guan J, et al. (2001)", "citation": "Guan J, et al. (2001) Cvt18/Gsa12 is required for cytoplasm-to-vacuole transport, pexophagy, and autophagy in Saccharomyces cerevisiae and Pichia pastoris. Mol Biol Cell 12(12):3821-38", "pubmed_id": 11739783, "link": "/reference/S000069684", "year": 2001, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1091/mbc.12.12.3821"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC60758/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11739783"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: NMR1", "date_created": "2010-02-16", "references": [{"id": 586676, "display_name": "Rabitsch KP, et al. (2001)", "citation": "Rabitsch KP, et al. (2001) A screen for genes required for meiosis and spore formation based on whole-genome expression. Curr Biol 11(13):1001-9", "pubmed_id": 11470404, "link": "/reference/S000060989", "year": 2001, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/s0960-9822(01)00274-3"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11470404"}, {"display_name": "Reference supplement", "link": "http://mendel.imp.univie.ac.at/meiosis"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: SVP1", "date_created": "2010-02-16", "references": [{"id": 543733, "display_name": "Dove SK, et al. (2004)", "citation": "Dove SK, et al. (2004) Svp1p defines a family of phosphatidylinositol 3,5-bisphosphate effectors. EMBO J 23(9):1922-33", "pubmed_id": 15103325, "link": "/reference/S000076078", "year": 2004, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1038/sj.emboj.7600203"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC404323/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/15103325"}]}]}, {"category": "Nomenclature history", "history_type": "LSP", "note": "Nomenclature history: The standard gene name of ORF YFR021W was changed from AUT10 to ATG18, as part of the unified autophagy nomenclature agreed upon by the yeast research community. Sept. 10, 2003", "date_created": "2003-09-10", "references": []}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide insertion was made in the intergenic region between ORFs YFR020W and ATG18/YFR021W.\r\n
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all ATG18 alleles in SGD search
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
View computational annotations
Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
290 total interactions for 205 unique genes
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2008-04-25
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
about the Cytoplasm-to-vacuole targeting (Cvt) pathway \r\nNew 194759 GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTCTTCTTCGGCCTGACAATGTCTG 194818\r\n |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||\r\nOld 194748 GTTAGTAATAGTGTTCCAGTTAACTCTGTATCCTTTTC-TCTTCGGCCTGACAATGTCTG 194806", "date_created": "2011-03-02", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-361", "display_name": "ATG2-ATG18 complex"}, {"format_name": "CPX-3088", "display_name": "PAS complex"}]},
tabs: {"id": 1282695, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
ATG18 / YFR021W Overview
Sequence
Analyze Sequence
S288C only
S288C vs. other species
S288C vs. other strains
Protein
Alleles
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Complex
Phenotype
Classical Genetics
Large-scale Survey
Interaction
Physical Interactions
Genetic Interactions
Regulation
Expression
Summary Paragraph
Literature
Resources