\n
\nNew: 6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTCGAAAAGGTATATTGGATGCCGGTTATTA 6900\n ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||\nOld: 6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTTGAAAAGGTATACTGGATGCCGGTTATTA 6900\n\nNew: 6901 CAGCCATCCTACTATGCGTAATCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960\n |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||\nOld: 6901 CAGCCATCCTACTATGCGTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960\n\nNew: 6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCGGATC 7020\n ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||\nOld: 6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCAGATC 7020\n\n
\nNew: 7081 CAGAAAGTTTCAGTTTCCTCGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140\n ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||\nOld: 7081 CAGAAAGTTTCAGTTTCCTTGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140", "date_created": "2005-08-24", "references": []}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Twelve separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. These changes resulted in 4 amino acid differences in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.\r\n\r\nOld: 6468 GATCAACATCCTGATTCCTTGTCACTTCGA 6497\r\n |||||||||||| ||| ||||| |||||||\r\nNew: 6477 GATCAACATCCTAATTTCTTGTTACTTCGA 6506\r\n\r\nOld: 6498 TTATGTTTAAAAAGTGCCTTGATTTGAGAGAAAATGTTTTCCTCATCTGGCAAGACAACC 6557\r\n |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||\r\nNew: 6507 TTATGTCTAAAAAGTGCCTTGATTTGAGAGAAAATATTTTCCTCATCTGGCAAGACAACC 6566\r\n\r\nOld: 6918 GTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCGCTCAAACCC 6977\r\n |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||\r\nNew: 6927 GTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCACTCAAACCC 6986\r\n\r\nOld: 7398 TTTGAATTGTGCCACTTTTGTGATGTCTCATTAGCCAACGTCAAAGGAACAAGAATACAC 7457\r\n ||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||\r\nNew: 7407 TTTGAATTGTGCCACTTCTGTGATGTCTCATTAGCCAACGTCAAAGGGACAAGGATACAC 7466\r\n\r\nOld: 7758 TACTGGTAAAACATTCTCCATTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCAGGAGC 7817\r\n |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||\r\nNew: 7767 TACTGGTAAAACATTCTCCACTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCAGGAGC 7826\r\n\r\nOld: 7938 AGCCTCAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTC 7997\r\n ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||\r\nNew: 7947 AGCCTTAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTT 8006", "date_created": "2005-12-22", "references": []}], "complexes": []}, tabs: {"id": 1277414, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false} };GEX1 | SGD GEX1 / YCL073C Overview
- Standard Name
- GEX1 1
- Systematic Name
- YCL073C
- SGD ID
- SGD:S000000575
- Feature Type
- ORF , Verified
- Description
- Proton:glutathione antiporter; localized to the vacuolar and plasma membranes; imports glutathione from the vacuole and exports it through the plasma membrane; has a role in resistance to oxidative stress and modulation of the PKA pathway; GEX1 has a paralog, GEX2, that arose from a segmental duplication 1 2 3
- Name Description
- Glutathione EXchanger 1
- Paralog
- GEX2 3
- Comparative Info

Sequence Details Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.
- Summary
- GEX1 has a paralog, GEX2, that arose from a segmental duplication
Analyze Sequence
S288C only
BLASTN | BLASTP | Design Primers | Restriction Fragment Map | Restriction Fragment Sizes | Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi | BLASTP at NCBI | BLASTP vs. fungi
S288C vs. other strains
Protein Details Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Length (a.a.)
- 615
- Mol. Weight (Da)
- 68934.9
- Isoelectric Point
- 9.11
Gene Ontology Details Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Solute:proton antiporter involved in glutathione transmembrane transport; localizes to plasma membrane and vacuolar membrane
View computational annotations
Molecular Function
- Manually Curated
Biological Process
- Manually Curated
- involved in glutathione transmembrane transport (IMP)
Cellular Component
- Manually Curated
- located in cell periphery (HDA)
- located in plasma membrane (IDA)
- located in vacuolar membrane (IDA)
Phenotype Details Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.
Classical Genetics
Large-scale Survey
- overexpression
Interaction Details Interaction
Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.
Regulation Details Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Regulators
- 6
- Targets
- 0
Expression Details Expression
Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.
Literature Details Literature
All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.
Resources