See More

gip1 haploid null mutants are viable, but homozygous diploid null mutants are unable to sporulate (1). Meiotic progression is normal in gip1 nulls, but Glc7p and septins display abnormal localization, and spore wall assembly is compromised (2).", "date_edited": "2005-10-10"}, "literature_overview": {"primary_count": 12, "additional_count": 12, "review_count": 11, "go_count": 2, "phenotype_count": 3, "disease_count": 0, "interaction_count": 18, "regulation_count": 3, "ptm_count": 0, "funComplement_count": 0, "htp_count": 14, "total_count": 59}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 5, "target_count": 0}, "reference_mapping": {"643484": 1, "571974": 2, "635404": 3}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: GIP1", "date_created": "2000-05-19", "references": [{"id": 643484, "display_name": "Tu J, et al. (1996)", "citation": "Tu J, et al. (1996) Protein phosphatase type 1 interacts with proteins required for meiosis and other cellular processes in Saccharomyces cerevisiae. Mol Cell Biol 16(8):4199-206", "pubmed_id": 8754819, "link": "/reference/S000041210", "year": 1996, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1128/MCB.16.8.4199"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC231417/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/8754819"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide was inserted within ORF GIP1/YBR045C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 66 amino acids longer. \r\n

\r\nNew    328369  CTCAGTCTATAATTTTCTGCTTCATTTCTCTGCCTTTTATACTCTGTATATTGAAAATAA  328428\r\n               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||\r\nOld    328368  CTCAGTCTATAATTT-CTGCTTCATTTCTCTGCCTTTTATACTCTGTATATTGAAAATAA  328426", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
        tabs: {"id": 1270841, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
    };


	
	
	
    
    
	
    GIP1 | SGD
    
	
	
	









	
	

GIP1 / YBR045C Overview


Standard Name
GIP1 1
Systematic Name
YBR045C
SGD ID
SGD:S000000249
Feature Type
ORF , Verified
Description
Meiosis-specific regulatory subunit of the Glc7p protein phosphatase; regulates spore wall formation and septin organization, required for expression of some late meiotic genes and for normal localization of Glc7p 1 2
Name Description
Glc7-Interacting Protein 1
Comparative Info
Sequence Details

Sequence

The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.


Summary
GIP1/YBR045C is located on the right arm of chromosome II, coding sequence is 1920 nucleotides long with 8 nonsynonymous SNPs
Protein Details

Protein

Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.


Length (a.a.)
639
Mol. Weight (Da)
73327.2
Isoelectric Point
4.84

Alleles

Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.


View all GIP1 alleles in SGD search

Gene Ontology Details

Gene Ontology

GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.


Summary
Protein phosphatase 1 regulator involved in ascospore wall assembly; localizes to prospore membrane

Molecular Function

Manually Curated

Biological Process

Manually Curated

Cellular Component

Manually Curated
Phenotype Details

Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.


Interaction Details

Interaction

Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.


48 total interactions for 36 unique genes

Physical Interactions

  • Affinity Capture-MS: 2
  • Affinity Capture-RNA: 1
  • Affinity Capture-Western: 2
  • Co-localization: 1
  • Two-hybrid: 7

Genetic Interactions

  • Negative Genetic: 28
  • Phenotypic Enhancement: 3
  • Phenotypic Suppression: 1
  • Positive Genetic: 2
  • Synthetic Rescue: 1
Regulation Details

Regulation

The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.


Regulators
5
Targets
0
Expression Details

Expression

Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.


Summary Paragraph

A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links to gene names and curated GO terms are included within the Summary Paragraphs.


Last Updated: 2005-10-10

Literature Details

Literature

All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.


Primary
12
Additional
12
Reviews
11

Resources


© Stanford University, Stanford, CA 94305.