See More

\r\n
YAL023C/PMT2 and YOR321W/PMT3\r\n
YAL028W/FRT2 and YOR324C/FRT1\r\n
YAL029C/MYO4 and YOR326W/MYO2\r\n
YAL030W/SNC1 and YOR327C/SNC2\r\n
YAL034C/FUN19 and YOR338W\r\n
YAL037W and YOR342C\r\n
YAL038W/CDC19 and YOR347C/PYK2\r\n
YAL051W/OAF1 and YOR363C/PIP2\r\n
YAL053W/FLC2 and YOR365C\r\n
YAL056W/GPB2 and YOR371C/GPB1\r\n
YAL062W/GDH3 and YOR375C/GDH1", "date_created": "2012-08-21", "references": [{"id": 526423, "display_name": "Byrne KP and Wolfe KH (2005)", "citation": "Byrne KP and Wolfe KH (2005) The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 15(10):1456-61", "pubmed_id": 16169922, "link": "/reference/S000113653", "year": 2005, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gr.3672305"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1240090/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/16169922"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Two separate single nucleotide substitutions were made in the intergenic region between ARS106 and ORF CDC19/YAL038W.\r\n

\r\nNew    70746   GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTAGTATTTTGGAGAT  70805\r\n               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||\r\nOld    70747   GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTACTATTTTGGAGAT  70806\r\n
\r\nNew    70856   TTATTTTTTTTTTGTTAGAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA  70915\r\n               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||\r\nOld    70857   TTATTTTTTTTTTGTTAAAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA  70916", "date_created": "2011-04-14", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-9181", "display_name": "SESAME metabolic enzyme complex"}]},
        tabs: {"id": 1268566, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
    };


	
	
	
    
    
	
    CDC19 | SGD
    
	
	
	









	
	

CDC19 / YAL038W Overview


Standard Name
CDC19 1
Systematic Name
YAL038W
SGD ID
SGD:S000000036
Aliases
PYK1 9
Feature Type
ORF , Verified
Description
Pyruvate kinase; functions as a homotetramer in glycolysis to convert phosphoenolpyruvate to pyruvate, the input for aerobic (TCA cycle) or anaerobic (glucose fermentation) respiration; regulated via allosteric activation by fructose bisphosphate; CDC19 has a paralog, PYK2, that arose from the whole genome duplication 2 4 5
Name Description
Cell Division Cycle 3
Paralog
PYK2 4
Comparative Info
Sequence Details

Sequence

The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.


Summary
CDC19 is located on the left arm of chromosome I between CYC3 cytochrome c heme lyase and YAL037C-A protein of unknown function; coding sequence is 1503 nucleotides long with 2 synonymous SNPs; CDC19 has paralog PYK2 from the whole genome duplication
Protein Details

Protein

Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.


Summary
Cdc19p is 500 amino acids long, longer-lived, extremely high in abundance; contains 7 pyruvate kinase domains; sumoylated on K240 and K475, acetylated on 17 lysines, succinylated on 15 lysines, ubiquitinylated on 24 lysines, phosphorylated on 50 residues
Length (a.a.)
500
Mol. Weight (Da)
54546.3
Isoelectric Point
7.78
Median Abundance (molecules/cell)
144590 +/- 77748
Half-life (hr)
11.7

Alleles

Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.


View all CDC19 alleles in SGD search

Gene Ontology Details

Gene Ontology

GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.


Summary
Pyruvate kinase that catalyzes the final step in glycolysis, the conversion of phosphoenolpyruvate to pyruvate, which is then utilized in anaerobic or aerobic respiration; localized to the cytoplasm

View computational annotations

Molecular Function

Manually Curated

Biological Process

Manually Curated

Cellular Component

Manually Curated

Complex

Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.


Pathways


Phenotype Details

Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.


Summary
Essential gene in reference strain S288C; heterozygous null mutant displays decreased fitness; conditional mutant is heat-sensitive and arrests in an unbudded state; overexpression confers chromosome instability
Interaction Details

Interaction

Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.


Summary
Cdc19p interacts physically with proteins involved in transcription; CDC19 interacts genetically with genes involved in transcription ; the cdc19 null mutant is inviable, the null mutant of paralog pyk2 is viable, the cdc19 pyk2 double mutant is inviable or displays a growth defect

468 total interactions for 391 unique genes

Physical Interactions

  • Affinity Capture-MS: 269
  • Affinity Capture-RNA: 10
  • Affinity Capture-Western: 9
  • Biochemical Activity: 10
  • Co-fractionation: 1
  • Co-localization: 3
  • PCA: 6
  • Protein-RNA: 7
  • Proximity Label-MS: 3
  • Reconstituted Complex: 6
  • Two-hybrid: 3

Genetic Interactions

  • Dosage Growth Defect: 1
  • Dosage Lethality: 1
  • Dosage Rescue: 2
  • Negative Genetic: 112
  • Phenotypic Enhancement: 2
  • Positive Genetic: 9
  • Synthetic Growth Defect: 2
  • Synthetic Lethality: 5
  • Synthetic Rescue: 7
Regulation Details

Regulation

The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.


Summary
CDC19 promoter is bound by Fhl1p, Fkh2p, Rgr1p, Spt3p, Spt7p, and Srb5p in response to heat; CDC19 transcription is upregulated by Ixr1p and downregulated by Msn2p/Msn4p; CDC19 transcription is upregulated by Znf1p during glycolysis and downregulated by Ixr1p during hypoxia; Gal4 protein activity is regulated by Cdc28p
Regulators
27
Targets
0
Expression Details

Expression

Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.


Summary Paragraph

A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links to gene names and curated GO terms are included within the Summary Paragraphs.


Last Updated: 2005-07-27

Literature Details

Literature

All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.


Primary
115
Additional
226
Reviews
38

Resources


© Stanford University, Stanford, CA 94305.