YAL023C/PMT2 and YOR321W/PMT3\r\n
YAL028W/FRT2 and YOR324C/FRT1\r\n
YAL029C/MYO4 and YOR326W/MYO2\r\n
YAL030W/SNC1 and YOR327C/SNC2\r\n
YAL034C/FUN19 and YOR338W\r\n
YAL037W and YOR342C\r\n
YAL038W/CDC19 and YOR347C/PYK2\r\n
YAL051W/OAF1 and YOR363C/PIP2\r\n
YAL053W/FLC2 and YOR365C\r\n
YAL056W/GPB2 and YOR371C/GPB1\r\n
YAL062W/GDH3 and YOR375C/GDH1", "date_created": "2012-08-21", "references": [{"id": 526423, "display_name": "Byrne KP and Wolfe KH (2005)", "citation": "Byrne KP and Wolfe KH (2005) The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 15(10):1456-61", "pubmed_id": 16169922, "link": "/reference/S000113653", "year": 2005, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gr.3672305"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1240090/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/16169922"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Two separate single nucleotide substitutions were made in the intergenic region between ARS106 and ORF CDC19/YAL038W.\r\n
\r\nNew 70746 GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTAGTATTTTGGAGAT 70805\r\n ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||\r\nOld 70747 GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTACTATTTTGGAGAT 70806\r\n\r\nNew 70856 TTATTTTTTTTTTGTTAGAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA 70915\r\n ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||\r\nOld 70857 TTATTTTTTTTTTGTTAAAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA 70916", "date_created": "2011-04-14", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-9181", "display_name": "SESAME metabolic enzyme complex"}]},
tabs: {"id": 1268566, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
CDC19 | SGD
CDC19 / YAL038W Overview
- Standard Name
- CDC19
1
- Systematic Name
- YAL038W
- SGD ID
- SGD:S000000036
- Aliases
-
PYK1
9
- Feature Type
- ORF
, Verified
- Description
-
Pyruvate kinase; functions as a homotetramer in glycolysis to convert phosphoenolpyruvate to pyruvate, the input for aerobic (TCA cycle) or anaerobic (glucose fermentation) respiration; regulated via allosteric activation by fructose bisphosphate; CDC19 has a paralog, PYK2, that arose from the whole genome duplication
2
4
5
- Name Description
- Cell Division Cycle
3
- Paralog
-
PYK2
4
- Comparative Info
-
Sequence Details
Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
- Summary
- CDC19 is located on the left arm of chromosome I between CYC3 cytochrome c heme lyase and YAL037C-A protein of unknown function; coding sequence is 1503 nucleotides long with 2 synonymous SNPs; CDC19 has paralog PYK2 from the whole genome duplication
Analyze Sequence
S288C only
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
S288C vs. other strains
Protein Details
Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Summary
- Cdc19p is 500 amino acids long, longer-lived, extremely high in abundance; contains 7 pyruvate kinase domains; sumoylated on K240 and K475, acetylated on 17 lysines, succinylated on 15 lysines, ubiquitinylated on 24 lysines, phosphorylated on 50 residues
- Length (a.a.)
- 500
- Mol. Weight (Da)
- 54546.3
- Isoelectric Point
- 7.78
- Median Abundance (molecules/cell)
- 144590 +/- 77748
- Half-life (hr)
- 11.7
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
CDC19-BY
|
CDC19-C
|
cdc19-(pyk1-D146N)
|
cdc19-(pyk1-T403E)
|
cdc19-1
|
cdc19-A336S
|
cdc19-D147N
|
... Show all
cdc19-E380A
|
cdc19-E380A,E392A
|
cdc19-Δ
Show fewer
View all CDC19 alleles in SGD search
Gene Ontology Details
Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Pyruvate kinase that catalyzes the final step in glycolysis, the conversion of phosphoenolpyruvate to pyruvate, which is then utilized in anaerobic or aerobic respiration; localized to the cytoplasm
View computational annotations
Molecular Function
- Manually Curated
-
enables
pyruvate kinase activity
(IDA,
IMP)
Biological Process
- Manually Curated
-
involved in
glycolytic process
(IMP)
Cellular Component
- Manually Curated
-
located in
cytoplasm
(IDA)
-
located in
plasma membrane
(HDA)
Complex
Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.
Pathways
Phenotype Details
Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
- Summary
- Essential gene in reference strain S288C; heterozygous null mutant displays decreased fitness; conditional mutant is heat-sensitive and arrests in an unbudded state; overexpression confers chromosome instability
Classical Genetics
- conditional
- reduction of function
Large-scale Survey
- null
- repressible
- reduction of function
- overexpression
- conditional
Interaction Details
Interaction
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
- Summary
- Cdc19p interacts physically with proteins involved in transcription; CDC19 interacts genetically with genes involved in transcription ; the cdc19 null mutant is inviable, the null mutant of paralog pyk2 is viable, the cdc19 pyk2 double mutant is inviable or displays a growth defect
468 total interactions for 391 unique genes
Physical Interactions
- Affinity Capture-MS: 269
- Affinity Capture-RNA: 10
- Affinity Capture-Western: 9
- Biochemical Activity: 10
- Co-fractionation: 1
- Co-localization: 3
- PCA: 6
- Protein-RNA: 7
- Proximity Label-MS: 3
- Reconstituted Complex: 6
- Two-hybrid: 3
Genetic Interactions
- Dosage Growth Defect: 1
- Dosage Lethality: 1
- Dosage Rescue: 2
- Negative Genetic: 112
- Phenotypic Enhancement: 2
- Positive Genetic: 9
- Synthetic Growth Defect: 2
- Synthetic Lethality: 5
- Synthetic Rescue: 7
Regulation Details
Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Summary
- CDC19 promoter is bound by Fhl1p, Fkh2p, Rgr1p, Spt3p, Spt7p, and Srb5p in response to heat; CDC19 transcription is upregulated by Ixr1p and downregulated by Msn2p/Msn4p; CDC19 transcription is upregulated by Znf1p during glycolysis and downregulated by Ixr1p during hypoxia; Gal4 protein activity is regulated by Cdc28p
- Regulators
-
27
- Targets
-
0
Expression Details
Expression
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
Summary Paragraph
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2005-07-27
Literature Details
Literature
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
Resources