Ribosomes are highly conserved large ribonucleoprotein (RNP) particles, consisting in yeast of a large 60S subunit and a small 40S subunit, that perform protein synthesis. Yeast ribosomes contain one copy each of four ribosomal RNAs (5S, 5.8S, 18S, and 25S; produced in two separate transcripts encoded within the rDNA repeat present as hundreds of copies on Chromosome 12) and 79 different ribosomal proteins (r-proteins), which are encoded by 137 different genes scattered about the genome, 59 of which are duplicated (5, 4). The 60S subunit contains 46 proteins and three RNA molecules: 25S RNA of 3392 nt, hydrogen bonded to the 5.8S RNA of 158 nt and associated with the 5S RNA of 121 nt. The 40S subunit has a single 18S RNA of 1798 nt and 33 proteins (6, 4). All yeast ribosomal proteins have a mammalian homolog (7). In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to the production of mRNAs for r-proteins. Coordinate regulation of the rRNA genes and 137 r-protein genes is affected by nutritional cues and a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, whose transcripts have naturally short lifetimes, leading to major implications for the expression of other genes as well (8, 9, 10). The expression of some r-protein genes is influenced by Abf1p (11), and most are directly induced by binding of Rap1p to their promoters, which excludes nucleosomes and recruits Fhl1p and Ifh1p to drive transcription (12). Ribosome assembly is a complex process, with different steps occurring in different parts of the cell. Ribosomal protein genes are transcribed in the nucleus, and the mRNA is transported to the cytoplasm for translation. The newly synthesized r-proteins then enter the nucleus and associate in the nucleolus with the two rRNA transcripts, one of which is methylated and pseudouridylated (
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP at NCBI |
BLASTP vs. fungi
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all RPL23A alleles in SGD search
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
View computational annotations
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
373 total interactions for 282 unique genes
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2007-02-14
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
\r\nNew 59399 ATTTCCCTTTTTCTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG 59458\r\n ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||\r\nOld 59396 ATTTCCCTTTT-CTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG 59454", "date_created": "2011-04-07", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide deletion was made in the intergenic region between ORFs RPL23A/YBL087C and YBL086C.\r\n\r\nNew 61019 AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTT-CAAAGCAGTTGGGGGTGT 61077\r\n ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||\r\nOld 61015 AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTTTCAAAGCAGTTGGGGGTGT 61074", "date_created": "2011-04-07", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
tabs: {"id": 1266982, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
RPL23A / YBL087C Overview
Sequence
Analyze Sequence
S288C only
S288C vs. other species
S288C vs. other strains
Protein
Alleles
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Phenotype
Classical Genetics
Large-scale Survey
Interaction
Physical Interactions
Genetic Interactions
Regulation
Expression
Summary Paragraph
Literature
Resources