See More

Ribosomes are highly conserved large ribonucleoprotein (RNP) particles, consisting in yeast of a large 60S subunit and a small 40S subunit, that perform protein synthesis. Yeast ribosomes contain one copy each of four ribosomal RNAs (5S, 5.8S, 18S, and 25S; produced in two separate transcripts encoded within the rDNA repeat present as hundreds of copies on Chromosome 12) and 79 different ribosomal proteins (r-proteins), which are encoded by 137 different genes scattered about the genome, 59 of which are duplicated (5, 4). The 60S subunit contains 46 proteins and three RNA molecules: 25S RNA of 3392 nt, hydrogen bonded to the 5.8S RNA of 158 nt and associated with the 5S RNA of 121 nt. The 40S subunit has a single 18S RNA of 1798 nt and 33 proteins (6, 4). All yeast ribosomal proteins have a mammalian homolog (7).

In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to the production of mRNAs for r-proteins. Coordinate regulation of the rRNA genes and 137 r-protein genes is affected by nutritional cues and a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, whose transcripts have naturally short lifetimes, leading to major implications for the expression of other genes as well (8, 9, 10). The expression of some r-protein genes is influenced by Abf1p (11), and most are directly induced by binding of Rap1p to their promoters, which excludes nucleosomes and recruits Fhl1p and Ifh1p to drive transcription (12).

Ribosome assembly is a complex process, with different steps occurring in different parts of the cell. Ribosomal protein genes are transcribed in the nucleus, and the mRNA is transported to the cytoplasm for translation. The newly synthesized r-proteins then enter the nucleus and associate in the nucleolus with the two rRNA transcripts, one of which is methylated and pseudouridylated (view sites of modifications), and then cleaved into three individual rRNAs (18S, 5.8S, and 25S) as part of the assembly process (5). Separate ribosomal subunits are then transported from the nucleolus to the cytoplasm where they assemble into mature ribosomes before functioning in translation (13, 14). Blockage of subunit assembly, such as due to inhibition of rRNA synthesis or processing, results in degradation of newly synthesized r-proteins (15, 14). (For more information on the early steps of rRNA processing and small ribosomal subunit assembly, see the summary paragraph for the U3 snoRNA, encoded by snR17A and snR17B.)", "date_edited": "2007-02-14"}, "literature_overview": {"primary_count": 23, "additional_count": 56, "review_count": 14, "go_count": 1, "phenotype_count": 4, "disease_count": 0, "interaction_count": 107, "regulation_count": 7, "ptm_count": 5, "funComplement_count": 0, "htp_count": 37, "total_count": 228}, "disease_overview": {"manual_disease_terms": [], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": null}, "ecnumbers": [], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 11, "target_count": 0}, "reference_mapping": {"592544": 1, "548623": 2, "526423": 3, "397935": 4, "592595": 5, "517471": 6, "556638": 7, "631529": 8, "554134": 9, "585697": 10, "608664": 11, "518051": 12, "592541": 13, "508692": 14, "508689": 15, "316136": 16}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: RPL23A", "date_created": "2000-05-19", "references": [{"id": 551590, "display_name": "SGD (2007)", "citation": "SGD (2007) Information without a citation in SGD ", "pubmed_id": null, "link": "/reference/S000073348", "year": 2007, "urls": []}]}, {"category": "Name", "history_type": "LSP", "note": "Name: L17aA", "date_created": "2010-02-16", "references": [{"id": 592544, "display_name": "Planta RJ and Mager WH (1998)", "citation": "Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7", "pubmed_id": 9559554, "link": "/reference/S000058461", "year": 1998, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1002/(SICI)1097-0061(19980330)14:5<471::AID-YEA241>3.0.CO;2-U"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9559554"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: L23A", "date_created": "2010-02-16", "references": [{"id": 592544, "display_name": "Planta RJ and Mager WH (1998)", "citation": "Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7", "pubmed_id": 9559554, "link": "/reference/S000058461", "year": 1998, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1002/(SICI)1097-0061(19980330)14:5<471::AID-YEA241>3.0.CO;2-U"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9559554"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: uL14", "date_created": "2016-08-09", "references": [{"id": 316136, "display_name": "Ban N, et al. (2014)", "citation": "Ban N, et al. (2014) A new system for naming ribosomal proteins. Curr Opin Struct Biol 24:165-9", "pubmed_id": 24524803, "link": "/reference/S000182084", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/j.sbi.2014.01.002"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4358319/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24524803"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: L14", "date_created": "2012-11-02", "references": [{"id": 397935, "display_name": "Jenner L, et al. (2012)", "citation": "Jenner L, et al. (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67", "pubmed_id": 22884264, "link": "/reference/S000150523", "year": 2012, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/j.sbi.2012.07.013"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/22884264"}]}]}, {"category": "Name", "history_type": "LSP", "note": "Name: YL32", "date_created": "2010-02-16", "references": [{"id": 592544, "display_name": "Planta RJ and Mager WH (1998)", "citation": "Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7", "pubmed_id": 9559554, "link": "/reference/S000058461", "year": 1998, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1002/(SICI)1097-0061(19980330)14:5<471::AID-YEA241>3.0.CO;2-U"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9559554"}]}]}, {"category": "Mapping", "history_type": "SEQUENCE", "note": "Mapping: Edition 14: RPL23A has previously been called RPL17A, but should not be confused with YKL180W which encodes ribosomal protein L17A", "date_created": "1997-10-20", "references": [{"id": 587084, "display_name": "Cherry JM, et al. (1997)", "citation": "Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73", "pubmed_id": 9169866, "link": "/reference/S000060841", "year": 1997, "urls": [{"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3057085/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9169866"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide insertion was made in the intergenic region between ORFs TEL1/YBL088C and RPL23A/YBL087C.\r\n

\r\nNew    59399   ATTTCCCTTTTTCTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG  59458\r\n               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||\r\nOld    59396   ATTTCCCTTTT-CTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG  59454", "date_created": "2011-04-07", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide deletion was made in the intergenic region between ORFs RPL23A/YBL087C and YBL086C.\r\n
\r\nNew    61019   AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTT-CAAAGCAGTTGGGGGTGT  61077\r\n               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||\r\nOld    61015   AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTTTCAAAGCAGTTGGGGGTGT  61074", "date_created": "2011-04-07", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
        tabs: {"id": 1266982, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
    };


	
	
	
    
    
	
    RPL23A | SGD
    
	
	
	









	
	

RPL23A / YBL087C Overview


Standard Name
RPL23A
Systematic Name
YBL087C
SGD ID
SGD:S000000183
Aliases
L17aA 1 , L23A 1 , YL32 1 , L14 4 , uL14 16
Feature Type
ORF , Verified
Description
Ribosomal 60S subunit protein L23A; homologous to mammalian ribosomal protein L23 and bacterial L14; RPL23A has a paralog, RPL23B, that arose from the whole genome duplication 1 2 3 4
Name Description
Ribosomal Protein of the Large subunit
Paralog
RPL23B 3
Comparative Info
Sequence Details

Sequence

The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.


Summary
RPL23A has a paralog, RPL23B, that arose from the whole genome duplication
Protein Details

Protein

Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.


Length (a.a.)
137
Mol. Weight (Da)
14485.3
Isoelectric Point
11.03
Median Abundance (molecules/cell)
12746 +/- 7162

Alleles

Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.


View all RPL23A alleles in SGD search

Gene Ontology Details

Gene Ontology

GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.


Summary
Subunit of the cytosolic large ribosomal subunit; involved in translation

View computational annotations

Molecular Function

Manually Curated

Biological Process

Manually Curated

Cellular Component

Manually Curated
Phenotype Details

Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.


Interaction Details

Interaction

Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.


Summary
The rpl23a null mutant is viable; the null mutant of paralog rpl23b is viable; the rpl23a rpl23b double mutant is inviable.

373 total interactions for 282 unique genes

Physical Interactions

  • Affinity Capture-MS: 130
  • Affinity Capture-RNA: 9
  • Affinity Capture-Western: 28
  • Biochemical Activity: 1
  • Co-fractionation: 1
  • Co-localization: 2
  • Co-purification: 2
  • Proximity Label-MS: 2
  • Reconstituted Complex: 8
  • Two-hybrid: 1

Genetic Interactions

  • Dosage Growth Defect: 1
  • Dosage Rescue: 3
  • Negative Genetic: 134
  • Phenotypic Suppression: 2
  • Positive Genetic: 38
  • Synthetic Growth Defect: 6
  • Synthetic Haploinsufficiency: 1
  • Synthetic Lethality: 3
  • Synthetic Rescue: 1
Regulation Details

Regulation

The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.


Regulators
11
Targets
0
Expression Details

Expression

Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.


Summary Paragraph

A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links to gene names and curated GO terms are included within the Summary Paragraphs.


Last Updated: 2007-02-14

Literature Details

Literature

All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.


Primary
23
Additional
56
Reviews
14

Resources


© Stanford University, Stanford, CA 94305.