Skip to main page content
U.S. flag
See More

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2011 Oct 21;286(42):36568-79.
doi: 10.1074/jbc.M111.248898. Epub 2011 Aug 17.

Evidence that eukaryotic translation elongation factor 1A (eEF1A) binds the Gcn2 protein C terminus and inhibits Gcn2 activity

Jyothsna Visweswaraiah  1 , Sebastien Lageix, Beatriz A Castilho, Lara Izotova, Terri Goss Kinzy, Alan G Hinnebusch, Evelyn Sattlegger
Affiliations

Evidence that eukaryotic translation elongation factor 1A (eEF1A) binds the Gcn2 protein C terminus and inhibits Gcn2 activity

Jyothsna Visweswaraiah et al. J Biol Chem. .

Abstract

The eukaryotic elongation factor 1A (eEF1A) delivers aminoacyl-tRNAs to the ribosomal A-site during protein synthesis. To ensure a continuous supply of amino acids, cells harbor the kinase Gcn2 and its effector protein Gcn1. The ultimate signal for amino acid shortage is uncharged tRNAs. We have proposed a model for sensing starvation, in which Gcn1 and Gcn2 are tethered to the ribosome, and Gcn1 is directly involved in delivering uncharged tRNAs from the A-site to Gcn2 for its subsequent activation. Gcn1 and Gcn2 are large proteins, and these proteins as well as eEF1A access the A-site, leading us to investigate whether there is a functional or physical link between these proteins. Using Saccharomyces cerevisiae cells expressing His(6)-eEF1A and affinity purification, we found that eEF1A co-eluted with Gcn2. Furthermore, Gcn2 co-immunoprecipitated with eEF1A, suggesting that they reside in the same complex. The purified GST-tagged Gcn2 C-terminal domain (CTD) was sufficient for precipitating eEF1A from whole cell extracts generated from gcn2Δ cells, independently of ribosomes. Purified GST-Gcn2-CTD and purified His(6)-eEF1A interacted with each other, and this was largely independent of the Lys residues in Gcn2-CTD known to be required for tRNA binding and ribosome association. Interestingly, Gcn2-eEF1A interaction was diminished in amino acid-starved cells and by uncharged tRNAs in vitro, suggesting that eEF1A functions as a Gcn2 inhibitor. Consistent with this possibility, purified eEF1A reduced the ability of Gcn2 to phosphorylate its substrate, eIF2α, but did not diminish Gcn2 autophosphorylation. These findings implicate eEF1A in the intricate regulation of Gcn2 and amino acid homeostasis.

PubMed Disclaimer

Figures

FIGURE 1.
FIGURE 1.
Gcn2 co-elutes with endogenously expressed His6-eEF1A. tef1Δ;tef2Δ double deletion strains expressing eEF1A from a plasmid from its own promotor, either untagged or His6-tagged (TKY864 and TKY865, respectively), were grown to exponential phase and harvested. Whole cell extracts were incubated with iMAC resin, and the resins were then subsequently washed with increasing concentrations of imidazole as indicated. Equal amounts of each washing step were subjected to SDS-PAGE, and the proteins were transferred to a PVDF membrane. The membrane was probed with Ponceau S to visualize His6-eEF1A and then was subjected to immunoblotting using antibodies against Gcn1, Gcn2, and the small ribosomal protein RPS22.
FIGURE 2.
FIGURE 2.
eEF1A co-immunoprecipitates Gcn2 but not Gcn1. Whole cell extracts from exponentially growing wild-type yeast strain H1511 were subjected to immunoprecipitation assays using anti-eEF1A antibodies or no antibodies as control, linked to Sepharose beads. Immunoprecipitates were subjected to SDS-PAGE and to immunoblotting assays using antibodies against Gcn1 and Gcn2. Lanes 1–3 and 4–6 represent two independent samples. I, 10% input; P, pellet; S, 10% supernatant. From the immunoblot, the percentage of total cellular Gcn1 or Gcn2 precipitated by Sepharose beads coated with eEF1A antibodies (α eEF1A) or no antibodies (no antibody) were calculated and the values plotted in a bar graph. The standard errors are indicated.
FIGURE 3.
FIGURE 3.
Gcn2-CTD is sufficient for forming a complex with eEF1A. 4 and 2 μg of GST-tagged Gcn2 fragments encompassing the Gcn2 N terminus (NTD, amino acids 1–272, plasmid pB131), the protein kinase domain (PK, 568–998, pHQ551), the HisRS-like domain (HisRS, 970–1497, pHQ530), the Gcn2 C terminus (CTD, 1498–1659, pHQ531), or GST alone (pGEX-5x-1), expressed in E. coli, were incubated with glutathione-linked beads and purified. The immobilized fragments were then incubated with whole cell extract generated from the exponentially grown gcn2Δ strain H2557. Unbound proteins were removed, and the precipitate was subjected to SDS-PAGE and immunoblotting using antibodies against GST, Gcn1, eEF1A, and the ribosomal protein RPS22. 20 μg (10%) and 10 μg (5%) of the gcn2Δ WCE was loaded (input). The full-length GST fusion proteins are indicated with asterisks.
FIGURE 4.
FIGURE 4.
Lys substitutions in the Gcn2-CTD affect ribosome co-precipitation more than eEF1A binding. A, various amounts (4 and 2 μg) of GST-Gcn2-CTD, of the same GST fusion protein but with K1552L/K1553I/K1556I substitutions (GST-Gcn2-CTD*K), or of GST alone as control, were subjected to co-precipitation assays and immunoblotting as described in Fig. 3. B, amount of proteins co-precipitated by the GST fusion proteins in A was quantified using the program ImageJ and determined relative to the precipitated amount of the respective GST fusion protein. These values were plotted relative to the co-precipitated values of GST-Gcn2-CTD. The standard errors are indicated as error bars. According to the t test the Lys substitutions significantly affected the Gcn2-CTD mediated co-precipitation of RPS22 (p value 0.002) and RPL39 (p value 0.033), whereas eEF1A co-precipitation was not significantly affected (p value 0.160).
FIGURE 5.
FIGURE 5.
Gcn2-CTD binds eEF1A independently of ribosomes. A, various amounts of WCE, and of the supernatant of WCE obtained from a high velocity centrifugation (PRS), were subjected to SDS-PAGE and immunoblotting using antibodies against eEF1A and RPS22 to verify that the amount of ribosomes was significantly reduced in the PRS. The top panel shows Ponceau S staining of the immunoblotting membrane. 1 x stands for the amount of total protein used (25 μg) in co-precipitation assays in B. B, GST-Gcn2-CTD, or GST alone as control, were subjected to co-precipitation assays using PRS or WCE (25 μg of total protein) from A, and then subjected to immunoblotting as described in Fig. 3.
FIGURE 6.
FIGURE 6.
Gcn2-CTD co-precipitates eEF1A in vitro. A, His6-eEF1A was purified from the gcn2Δ strain ESY10101 as outlined under “Experimental Procedures.” An aliquot of purified His6-eEF1A was subjected to SDS-PAGE and Coomassie staining to verify the purity of the protein. B, various amounts of purified His6-eEF1A from A, as indicated, were resolved via SDS-PAGE next to various total protein amounts of yeast whole cell extract and subjected to immunoblotting using antibodies against eEF1A and RPS22. The top panel shows Ponceau S staining of the immunoblotting membrane, and the eEF1A band is indicated with *. C, E. coli extracts harboring overexpressed GST-Gcn2-CTD, GST-Gcn2-CTD*K, or GST alone, respectively, were incubated with glutathione-linked Sepharose beads for 20 min, and then 2 μg of purified His6-eEF1A was added. After 1 h of incubation, unbound proteins were removed, and the glutathione-bound precipitates were subjected to SDS-PAGE and immunoblotting using antibodies against eEF1A and GST. The input reflects 1% of the amount of eEF1A used for each pulldown sample. D, Gcn2-CTD-eEF1A interaction in C is not mediated by RNA. The same experiment was conducted as in C, just that before starting the binding assay the E. coli extracts and eEF1A were treated with RNase A for 15 min at 4 °C. The input reflects 1% of the amount of eEF1A treated with RNase A and then used for each pulldown sample. E, RNase was functional in D. 1 μg of total yeast RNA was incubated with RNase, or not (control), using the same experimental conditions as in D, and then subjected to agarose gel electrophoresis and ethidium bromide staining.
FIGURE 7.
FIGURE 7.
eEF1A-Gcn2 interaction is lost under starvation conditions in vivo and in presence of uncharged tRNAs in vitro. A, same assay was performed as in Fig. 1, using His6-eEF1A strain TKY865 grown under replete conditions (unstarved), or treated with sulfometuron (SM, 1 μg/ml final concentration) 30 min prior to harvesting to elicit starvation for branched amino acids (starved). The immunoblot was probed with antibodies directed against the proteins indicated in the figure. B, 2 μg of purified Gcn2 was incubated with various amounts of uncharged tRNAPhe for 20 min, or as control Gcn2 was incubated with no tRNA. Then Gcn2 was added to 3 μg of His6-eEF1A bound to iMAC resin (200-μl reaction volume). After 60 min of incubation, the resin was washed, and the precipitates were subjected to SDS-PAGE and Western blotting using antibodies against His6 and Gcn2. The amount of co-precipitated Gcn2 was quantified relative to the respective amount of precipitated eEF1A using ImageJ, and the values are shown in a graph relative to the level of Gcn2 precipitation in the absence of any RNA. C, same assay was performed as in B using no RNA, 0.1 and 0.3 μm tRNAPhe, or 0.1 and 0.3 μm synthetic mRNA (GGAAUCUCUCUCUCUCUCUAUGCUCUCUCUCUCUCUCUCUCUC).
FIGURE 8.
FIGURE 8.
eEF1A inhibits Gcn2-mediated eIF2α phosphorylation but not Gcn2 auto-phosphorylation. A, 1 pmol of purified Gcn2 and/or 10 pmol of purified untagged eEF1A as indicated were incubated at 30 °C in the presence of BSA before being subjected to a second incubation with 30 pmol of recombinant eIF2α and 100 pmol of [γ-32P]ATP for 20 min. Samples were then subjected to SDS-PAGE; the gel was subjected to Coomassie staining and autoradiography (right panel), and then the gel was dried and the Coomassie staining documented (left panel). The location of protein bands of Gcn2, BSA, eEF1A, and eIF2α (a C-terminally truncated version of yeast eIF2α) are indicated, as well as 40- and 10-kDa bands observed in the autoradiogram. A second independent experiment showed similar results. B, same assay was conducted as in A, lane 3, just that 200 pmol of [γ-32P]ATP was used and various amounts of eEF1A (1, 5, and 10 pmol). C, levels of Gcn2 auto-phosphorylation (Gcn2-P), eIF2α phosphorylation (eIF2α-P), and phosphorylation of the 10-kDa protein (10 kDa-P), in A and B, were determined by quantifying the intensity of the respective bands. The values were normalized to that of Gcn2 in the absence of eEF1A (for Gcn2-P and eIF2-P) and to that of eEF1A in the absence of Gcn2 (for 10 kDa-P). Data were obtained from 4, 2, 1, 2, and 1 experiments (columns from left to right), and standard errors are indicated where applicable. D, same assay as in B was conducted but using 0, 1, 5, 10, and 50 pmol of His6-tagged eEF1A from Fig. 6. If indicated eEF1A was heat-inactivated prior to the enzyme assay (10 min at 95 °C). The levels of Gcn2 auto-phosphorylation (Gcn2-P) and eIF2α phosphorylation (eIF2α-P) were determined as outlined in C. E, same assay as in D was conducted using 10 pmol of His6-eEF1A, just that the kinase reaction was terminated after various times, i.e. 5, 10, 20, and 40 min. The levels of Gcn2 auto-phosphorylation (Gcn2-P) and eIF2α phosphorylation (eIF2α-P) were determined as outlined in C, relative to the phosphorylation level after 20 min of kinase reaction and in the absence of eEF1A and plotted in a line graph.
FIGURE 9.
FIGURE 9.
Model for eEF1A-mediated Gcn2 inhibition. A, this schematic depicts the individual domains in Gcn2 (modified from Ref. 2). The N-terminal domain harbors the Gcn1 binding activity (Gcn1 BD), and the adjacent domain shows homology to protein kinases but is not enzymatically functional (ΨPK). In nonstarved cells the Gcn2 HisRS-like domain and C-terminal domain (CTD) contact the protein kinase (PK) domain (depicted as N- (PKN) and C-lobes (PKC)). The PK domain is in its inactive conformation that prevents ATP binding, autophosphorylation, and eIF2α phosphorylation. In this study, we have found that eEF1A binds to the CTD. Our data suggest that eEF1A binding prevents eIF2α phosphorylation only but not Gcn2 autophosphorylation. B, under starvation conditions uncharged tRNA binds to the HisRS/CTD leading to its conformational change that is transmitted to the PK domain that now is able to bind ATP and autophosphorylate. Because eEF1A is released from Gcn2, Gcn2 is able to phosphorylate its substrate eIF2α. The mechanism leading to eEF1A-Gcn2 dissociation remains to be determined; however, our data suggest that uncharged tRNAs may be a contributing factor by competing with eEF1A for Gcn2 binding. For more, see the text.
See this image and copyright information in PMC

References

    1. Taylor D. R., Frank J., Kinzy T. G. (eds) (2007) Translational Control in Biology and Medicine (Mathews M. B., Sonenberg N., Hershey J. W. B. eds) Monograph Series 48, pp. 59–85, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
    1. Hinnebusch A. G. (2005) Annu. Rev. Microbiol. 59, 407–450 - PubMed
    1. Sattlegger E., Hinnebusch A. G., Barthelmess I. B. (1998) J. Biol. Chem. 273, 20404–20416 - PubMed
    1. Sasse C., Bignell E. M., Hasenberg M., Haynes K., Gunzer M., Braus G. H., Krappmann S. (2008) Fungal Genet. Biol. 45, 693–704 - PubMed
    1. Hood H. M., Neafsey D. E., Galagan J., Sachs M. S. (2009) Annu. Rev. Microbiol. 63, 385–409 - PubMed

Publication types

MeSH terms