Abstract
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.
Full text
PDF



Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Brownlee G. G., Sanger F., Barrell B. G. Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli. Nature. 1967 Aug 12;215(5102):735–736. doi: 10.1038/215735a0. [DOI] [PubMed] [Google Scholar]
- Fox G. E., Woese C. R. 5S RNA secondary structure. Nature. 1975 Aug 7;256(5517):505–507. doi: 10.1038/256505a0. [DOI] [PubMed] [Google Scholar]
- Hori H. Molecular evolution of 5S RNA. Mol Gen Genet. 1976 May 7;145(2):119–123. doi: 10.1007/BF00269583. [DOI] [PubMed] [Google Scholar]
- Hori H., Osawa S. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381–385. doi: 10.1073/pnas.76.1.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marotta C. A., Varricchio F., Smith I., Weissman S. M. The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids. J Biol Chem. 1976 May 25;251(10):3122–3127. [PubMed] [Google Scholar]
- Nazar R. N., Matheson A. T., Bellemare G. Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms. J Biol Chem. 1978 Aug 10;253(15):5464–5469. [PubMed] [Google Scholar]
- Nishimura S. Minor components in transfer RNA: their characterization, location, and function. Prog Nucleic Acid Res Mol Biol. 1972;12:49–85. [PubMed] [Google Scholar]
- Rubin G. M. Preparation of RNA and ribosomes from yeast. Methods Cell Biol. 1975;12:45–64. doi: 10.1016/s0091-679x(08)60951-6. [DOI] [PubMed] [Google Scholar]
- Silberklang M., Prochiantz A., Haenni A. L., Rajbhandary U. L. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA. Eur J Biochem. 1977 Feb;72(3):465–478. doi: 10.1111/j.1432-1033.1977.tb11270.x. [DOI] [PubMed] [Google Scholar]
