\r\nNew 643559 TCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT 643618\r\n ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||\r\nOld 643556 TCGAATTTTTTCTTTTTTTTTTTTTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT 643615", "date_created": "2011-02-09", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Nucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine. \r\nNew 642949 GGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCA 643018\r\n ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||\r\nOld 642946 GGTTGTCACGCTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTACGAAATACATCGAACAAGCCA 643015\r\n", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
tabs: {"id": 1283044, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
GLN1 | SGD
GLN1 / YPR035W Overview
- Standard Name
- GLN1
1
- Systematic Name
- YPR035W
- SGD ID
- SGD:S000006239
- Feature Type
- ORF
, Verified
- Description
-
Glutamine synthetase (GS); synthesizes glutamine from glutamate and ammonia; with Glt1p, forms the secondary pathway for glutamate biosynthesis from ammonia; expression regulated by nitrogen source and by amino acid limitation; forms filaments of back-to-back stacks of cylindrical homo-decamers at low pH, leading to enzymatic inactivation and storage during states of advanced cellular starvation; relocalizes from nucleus to cytoplasmic foci upon DNA replication stress
2
3
4
5
6
- Name Description
- GLutamiNe metabolism
1
- Comparative Info
-
Sequence Details
Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
Analyze Sequence
S288C only
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
S288C vs. other strains
Protein Details
Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Summary
- Gln1p is 370 amino acids long, short-lived, moderate in abundance; succinylated on K324, acetylated on 6 lysines, phosphorylated on 8 serines, ubiquitinylated on 8 lysines
- Length (a.a.)
- 370
- Mol. Weight (Da)
- 41759.5
- Isoelectric Point
- 6.29
- Median Abundance (molecules/cell)
- 38231 +/- 37111
- Half-life (hr)
- 6.7
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all GLN1 alleles in SGD search
Gene Ontology Details
Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Glutamate-ammonia ligase involved in glutamine biosynthesis; localizes to nuclear periphery
View computational annotations
Molecular Function
- Manually Curated
-
enables
glutamine synthetase activity
(IMP,
IDA)
Biological Process
- Manually Curated
-
involved in
glutamine biosynthetic process
(IDA)
Pathways
Phenotype Details
Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
- Summary
- GLN1/YPR035W is an essential gene in strain S288C, in which null mutants are inviable, but non-essential gene in strain Sigma1278b, where null mutation causes glutamine auxotrophy and reduced filamentous growth; reduction of function mutations lead to hypoosmotic stress sensitivity rescuable by osmotic support in growth medium
Classical Genetics
- unspecified
- reduction of function
Large-scale Survey
- null
- reduction of function
- conditional
Interaction Details
Interaction
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
- Summary
- Gln1p interacts physically with proteins involved in protein catabolism; GLN1 interacts genetically with genes involved in transcription
189 total interactions for 165 unique genes
Physical Interactions
- Affinity Capture-MS: 53
- Affinity Capture-RNA: 9
- Affinity Capture-Western: 5
- Biochemical Activity: 4
- Co-crystal Structure: 1
- Co-localization: 1
- Co-purification: 1
- PCA: 2
- Protein-peptide: 1
- Proximity Label-MS: 1
- Reconstituted Complex: 10
- Two-hybrid: 1
Genetic Interactions
- Dosage Lethality: 1
- Negative Genetic: 90
- Phenotypic Enhancement: 2
- Positive Genetic: 4
- Synthetic Lethality: 1
- Synthetic Rescue: 2
Regulation Details
Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Regulators
-
10
- Targets
-
0
Expression Details
Expression
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
Summary Paragraph
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2007-10-04
Literature Details
Literature
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
Resources