|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 760715 CTTGAACAATTTTGATTTAGAGGCTTGAACATCATTCAAAATGCCCTGCCTGCCATAGGA 760774", "date_created": "2004-02-04", "references": [{"id": 631304, "display_name": "Roemer T, et al. (1998)", "citation": "Roemer T, et al. (1998) The Spa2-related protein, Sph1p, is important for polarized growth in yeast. J Cell Sci 111 ( Pt 4):479-94", "pubmed_id": 9443897, "link": "/reference/S000045317", "year": 1998, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1242/jcs.111.4.479"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9443897"}]}]}], "complexes": []}, tabs: {"id": 1286550, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false} };
SPH1 / YLR313C Overview
- Standard Name
- SPH1 1
- Systematic Name
- YLR313C
- SGD ID
- SGD:S000004305
- Aliases
- YLR312C-B 2
- Feature Type
- ORF , Verified
- Description
- Protein involved in shmoo formation and bipolar bud site selection; localizes to sites of polarized growth in a cell cycle dependent- and Spa2p-dependent manner, interacts with MAPKKs Mkk1p, Mkk2p, and Ste7p; SPH1 has a paralog, SPA2, that arose from the whole genome duplication 1 2 3
- Name Description
- SPa2 Homolog 1
- Paralog
- SPA2 3
- Comparative Info
-
Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.
- Summary
- SPH1 has a paralog, SPA2, that arose from the whole genome duplication
Analyze Sequence
S288C only
BLASTN | BLASTP | Design Primers | Restriction Fragment Map | Restriction Fragment Sizes | Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi | BLASTP at NCBI | BLASTP vs. fungi
S288C vs. other strains
Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Length (a.a.)
- 530
- Mol. Weight (Da)
- 59012.8
- Isoelectric Point
- 9.54
- Median Abundance (molecules/cell)
- 672
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all SPH1 alleles in SGD search
Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Protein involved in invasive filamentous growth, pseudohyphal growth, and bud site selection; localized to the cellular bud tip and neck, mating projections, and site of bud emergence
View computational annotations
Molecular Function
- Manually Curated
- enables molecular function unknown (ND)
Biological Process
- Manually Curated
- involved in bipolar cellular bud site selection (IMP)
- involved in invasive filamentous growth (IGI)
- involved in pseudohyphal growth (IMP)
Cellular Component
- Manually Curated
- located in cellular bud neck (IDA)
- located in cellular bud tip (IDA)
- located in incipient cellular bud site (IDA)
- located in mating projection (IDA)
Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.
Classical Genetics
- null
- unspecified
- overexpression
Large-scale Survey
Interaction
Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.
- Summary
- The sph1 null mutant is viable; the null mutant of paralog spa2 is viable; the sph1 spa2 double mutant displays a phenotypic enhancement.
102 total interactions for 91 unique genes
Physical Interactions
- Affinity Capture-MS: 2
- Affinity Capture-RNA: 5
- Affinity Capture-Western: 1
- Co-localization: 1
- Cross-Linking-MS (XL-MS): 1
- PCA: 1
- Two-hybrid: 6
Genetic Interactions
- Dosage Rescue: 2
- Negative Genetic: 71
- Phenotypic Suppression: 1
- Positive Genetic: 4
- Synthetic Growth Defect: 4
- Synthetic Lethality: 1
- Synthetic Rescue: 2
Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Regulators
- 1
- Targets
- 0
Expression
Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.
Literature
All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.