See More

\r\n

Old: 393481 TAAATGGGCACATCAAATATGAAACTCCCCTAATTGAATTGTTAA-GCGGTCTTTTAGAT 393539\r\n            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||\r\nNew: 393481 TAAATGGGCACATCAAATATGAAACTCCCCTAATTGAATTGTTAAAGCGGTCTTTTAGAT 393540", "date_created": "2003-01-03", "references": [{"id": 573486, "display_name": "Blandin G, et al. (2000)", "citation": "Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6", "pubmed_id": 11152879, "link": "/reference/S000065690", "year": 2000, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1016/s0014-5793(00)02275-4"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11152879"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Nucleotide changes within the coding region of PKP2/YGL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 224-225 are now SI rather than VY. 
\r\nNew    392862   TCAAGAAGATTGATTGTAGAGGAACACGTCAGTAT-CACAGCCAACTACACTAGTGGTAA  392920\r\n                |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||\r\nOld    392867   TCAAGAAGATTGATTGTAGAGGAACACGTC-GTATACACAGCCAACTACACTAGTGGTAA  392925\r\n", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
        tabs: {"id": 1282776, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
    };


	
	
	
    
    
	
    PKP2 | SGD
    
	
	
	









	
	

PKP2 / YGL059W Overview


Standard Name
PKP2 1
Systematic Name
YGL059W
SGD ID
SGD:S000003027
Feature Type
ORF , Verified
Description
Mitochondrial protein kinase; negatively regulates activity of the pyruvate dehydrogenase complex by phosphorylating the ser-133 residue of the Pda1p subunit; acts in concert with kinase Pkp1p and phosphatases Ptc5p and Ptc6p; relocalizes from mitochondrion to cytoplasm upon DNA replication stress 1 2 3 4
Name Description
Protein Kinase of PDH 1
Comparative Info
Sequence Details

Sequence

The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.


Protein Details

Protein

Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.


Summary
Relocalizes from mitochondrion to cytoplasm upon DNA replication stress
Length (a.a.)
491
Mol. Weight (Da)
57296.4
Isoelectric Point
8.17
Median Abundance (molecules/cell)
1219 +/- 557

Alleles

Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.


View all PKP2 alleles in SGD search

Gene Ontology Details

Gene Ontology

GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.


Summary
Mitochondrial protein kinase that also has pyruvate dehydrogenase (acetyl-transferring) kinase activity; involved in carbon utilization, regulation of mitophagy, and negative regulation of pyruvate dehydrogenase activity

View computational annotations

Molecular Function

Manually Curated

Biological Process

Manually Curated

Cellular Component

Manually Curated
Phenotype Details

Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.


Interaction Details

Interaction

Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.


165 total interactions for 151 unique genes

Physical Interactions

  • Affinity Capture-MS: 8
  • Affinity Capture-RNA: 6
  • Affinity Capture-Western: 2
  • Biochemical Activity: 92
  • Co-localization: 1

Genetic Interactions

  • Negative Genetic: 32
  • Phenotypic Enhancement: 2
  • Phenotypic Suppression: 1
  • Positive Genetic: 15
  • Synthetic Growth Defect: 6
Regulation Details

Regulation

The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.


Regulators
6
Targets
0
Expression Details

Expression

Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.


Literature Details

Literature

All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.


Primary
9
Additional
9
Reviews
7

Resources


© Stanford University, Stanford, CA 94305.