\r\nNew 392862 TCAAGAAGATTGATTGTAGAGGAACACGTCAGTAT-CACAGCCAACTACACTAGTGGTAA 392920\r\n |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||\r\nOld 392867 TCAAGAAGATTGATTGTAGAGGAACACGTC-GTATACACAGCCAACTACACTAGTGGTAA 392925\r\n", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
tabs: {"id": 1282776, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
PKP2 | SGD
PKP2 / YGL059W Overview
- Standard Name
- PKP2
1
- Systematic Name
- YGL059W
- SGD ID
- SGD:S000003027
- Feature Type
- ORF
, Verified
- Description
-
Mitochondrial protein kinase; negatively regulates activity of the pyruvate dehydrogenase complex by phosphorylating the ser-133 residue of the Pda1p subunit; acts in concert with kinase Pkp1p and phosphatases Ptc5p and Ptc6p; relocalizes from mitochondrion to cytoplasm upon DNA replication stress
1
2
3
4
- Name Description
- Protein Kinase of PDH
1
- Comparative Info
-
Sequence Details
Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
Analyze Sequence
S288C only
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
S288C vs. other strains
Protein Details
Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Summary
- Relocalizes from mitochondrion to cytoplasm upon DNA replication stress
- Length (a.a.)
- 491
- Mol. Weight (Da)
- 57296.4
- Isoelectric Point
- 8.17
- Median Abundance (molecules/cell)
- 1219 +/- 557
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all PKP2 alleles in SGD search
Gene Ontology Details
Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Mitochondrial protein kinase that also has pyruvate dehydrogenase (acetyl-transferring) kinase activity; involved in carbon utilization, regulation of mitophagy, and negative regulation of pyruvate dehydrogenase activity
View computational annotations
Molecular Function
- Manually Curated
-
enables
protein kinase activity
(HDA,
IDA)
-
enables
pyruvate dehydrogenase (acetyl-transferring) kinase activity
(IMP)
Biological Process
- Manually Curated
-
involved in
regulation of mitophagy
(IMP)
Cellular Component
- Manually Curated
-
located in
mitochondrion
(IDA,
HDA)
Phenotype Details
Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
Classical Genetics
Interaction Details
Interaction
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
165 total interactions for 151 unique genes
Physical Interactions
- Affinity Capture-MS: 8
- Affinity Capture-RNA: 6
- Affinity Capture-Western: 2
- Biochemical Activity: 92
- Co-localization: 1
Genetic Interactions
- Negative Genetic: 32
- Phenotypic Enhancement: 2
- Phenotypic Suppression: 1
- Positive Genetic: 15
- Synthetic Growth Defect: 6
Regulation Details
Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Regulators
-
6
- Targets
-
0
Expression Details
Expression
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
Literature Details
Literature
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
Resources