References:
1. Sequence verification in AB972 (S288c derivative strain) background by SGD.
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all SAP155 alleles in SGD search
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
View computational annotations
Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
474 total interactions for 352 unique genes
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
2. Personal communication from Margaret Shirra, University of Pittsburgh. Old: 234421 CATGGTGATGAAGTGAAAACGGCACGTGGGAGATCAGAAGAGTCGATTTGAGAAGGATGA 234480\r\n ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||\r\nNew: 234421 CATGGTGATGAAGTGAAAACGGCACGTGG-AGATCAGAAGAGTCGATTTGAGAAGGATGA 234479", "date_created": "2003-09-26", "references": [{"id": 549853, "display_name": "Cliften P, et al. (2003)", "citation": "Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6", "pubmed_id": 12775844, "link": "/reference/S000073948", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1126/science.1084337"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12775844"}, {"display_name": "Reference supplement", "link": "http://www.sciencemag.org/cgi/content/full/1084337/DC1"}]}, {"id": 550654, "display_name": "Brachat S, et al. (2003)", "citation": "Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45", "pubmed_id": 12844361, "link": "/reference/S000073670", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1186/gb-2003-4-7-r45"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC193632/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12844361"}]}, {"id": 551672, "display_name": "Kellis M, et al. (2003)", "citation": "Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54", "pubmed_id": 12748633, "link": "/reference/S000073327", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1038/nature01644"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12748633"}, {"display_name": "Reference supplement", "link": "http://www.nature.com/nature/journal/v423/n6937/suppinfo/nature01644.html"}]}, {"id": 564428, "display_name": "Jablonowski D, et al. (2001)", "citation": "Jablonowski D, et al. (2001) Sit4p protein phosphatase is required for sensitivity of Saccharomyces cerevisiae to Kluyveromyces lactis zymocin. Genetics 159(4):1479-89", "pubmed_id": 11779790, "link": "/reference/S000068918", "year": 2001, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1093/genetics/159.4.1479"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1461913/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11779790"}]}, {"id": 601653, "display_name": "Luke MM, et al. (1996)", "citation": "Luke MM, et al. (1996) The SAP, a new family of proteins, associate and function positively with the SIT4 phosphatase. Mol Cell Biol 16(6):2744-55", "pubmed_id": 8649382, "link": "/reference/S000055325", "year": 1996, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1128/MCB.16.6.2744"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC231265/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/8649382"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Nucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine. \r\nNew 236219 ATGAAGCAAAACATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA 236278\r\n |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||\r\nOld 236206 ATGAAGCAAACCATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA 236265", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-1864", "display_name": "SIT4-SAP155 phosphatase complex"}]},
tabs: {"id": 1267251, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
SAP155 / YFR040W Overview
Sequence
Analyze Sequence
S288C only
S288C vs. other species
S288C vs. other strains
Protein
Alleles
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Complex
Phenotype
Classical Genetics
Large-scale Survey
Interaction
Physical Interactions
Genetic Interactions
Regulation
Expression
Literature
Resources