See More

References:

1. Sequence verification in AB972 (S288c derivative strain) background by SGD.
2. Personal communication from Margaret Shirra, University of Pittsburgh.

Old: 234421 CATGGTGATGAAGTGAAAACGGCACGTGGGAGATCAGAAGAGTCGATTTGAGAAGGATGA 234480\r\n            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||\r\nNew: 234421 CATGGTGATGAAGTGAAAACGGCACGTGG-AGATCAGAAGAGTCGATTTGAGAAGGATGA 234479", "date_created": "2003-09-26", "references": [{"id": 549853, "display_name": "Cliften P, et al. (2003)", "citation": "Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6", "pubmed_id": 12775844, "link": "/reference/S000073948", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1126/science.1084337"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12775844"}, {"display_name": "Reference supplement", "link": "http://www.sciencemag.org/cgi/content/full/1084337/DC1"}]}, {"id": 550654, "display_name": "Brachat S, et al. (2003)", "citation": "Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45", "pubmed_id": 12844361, "link": "/reference/S000073670", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1186/gb-2003-4-7-r45"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC193632/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12844361"}]}, {"id": 551672, "display_name": "Kellis M, et al. (2003)", "citation": "Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54", "pubmed_id": 12748633, "link": "/reference/S000073327", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1038/nature01644"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12748633"}, {"display_name": "Reference supplement", "link": "http://www.nature.com/nature/journal/v423/n6937/suppinfo/nature01644.html"}]}, {"id": 564428, "display_name": "Jablonowski D, et al. (2001)", "citation": "Jablonowski D, et al. (2001) Sit4p protein phosphatase is required for sensitivity of Saccharomyces cerevisiae to Kluyveromyces lactis zymocin. Genetics 159(4):1479-89", "pubmed_id": 11779790, "link": "/reference/S000068918", "year": 2001, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1093/genetics/159.4.1479"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1461913/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/11779790"}]}, {"id": 601653, "display_name": "Luke MM, et al. (1996)", "citation": "Luke MM, et al. (1996) The SAP, a new family of proteins, associate and function positively with the SIT4 phosphatase. Mol Cell Biol 16(6):2744-55", "pubmed_id": 8649382, "link": "/reference/S000055325", "year": 1996, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1128/MCB.16.6.2744"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC231265/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/8649382"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Nucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine. 
\r\nNew    236219  ATGAAGCAAAACATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA  236278\r\n               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||\r\nOld    236206  ATGAAGCAAACCATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAA  236265", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-1864", "display_name": "SIT4-SAP155 phosphatase complex"}]},
        tabs: {"id": 1267251, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
    };


	
	
	
    
    
	
    SAP155 | SGD
    
	
	
	









	
	

SAP155 / YFR040W Overview


Standard Name
SAP155 1
Systematic Name
YFR040W
SGD ID
SGD:S000001936
Feature Type
ORF , Verified
Description
Protein required for function of the Sit4p protein phosphatase; forms a complex with Sit4p; member of a family of similar proteins including Sap4p, Sap185p, and Sap190p; protein abundance increases in response to DNA replication stress; SAP155 has a paralog, SAP4, that arose from the whole genome duplication 1 2 3
Name Description
Sit4 Associated Protein 1
Paralog
SAP4 3
Comparative Info
Sequence Details

Sequence

The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.


Summary
SAP155/YFR040W is located on the right arm of chromosome VI, coding sequence is 3009 nucleotides long with 9 nonsynonymous SNPs; SAP155 has a paralog, SAP4, that arose from the whole genome duplication
Protein Details

Protein

Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.


Summary
Protein abundance increases in response to DNA replication stress
Length (a.a.)
1002
Mol. Weight (Da)
114925.8
Isoelectric Point
4.31
Median Abundance (molecules/cell)
3506 +/- 683
Half-life (hr)
8.7

Alleles

Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.


View all SAP155 alleles in SGD search

Gene Ontology Details

Gene Ontology

GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.


Summary
Subunit of the SIT4-SAP155 phosphatase complex that mediates G1/S mitotic cell cycle progression

View computational annotations

Molecular Function

Manually Curated

Cellular Component

Manually Curated

Complex

Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.


Phenotype Details

Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.


Interaction Details

Interaction

Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.


Summary
The sap155 null mutant is viable; the null mutant of paralog sap4 is viable; the sap155 sap4 double mutant displays a synthetic growth defect.

474 total interactions for 352 unique genes

Physical Interactions

  • Affinity Capture-MS: 30
  • Affinity Capture-RNA: 10
  • Affinity Capture-Western: 5
  • PCA: 7
  • Two-hybrid: 5

Genetic Interactions

  • Dosage Growth Defect: 1
  • Dosage Lethality: 3
  • Dosage Rescue: 10
  • Negative Genetic: 336
  • Phenotypic Enhancement: 1
  • Positive Genetic: 36
  • Synthetic Growth Defect: 21
  • Synthetic Lethality: 5
  • Synthetic Rescue: 4
Regulation Details

Regulation

The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.


Regulators
4
Targets
0
Expression Details

Expression

Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.


Literature Details

Literature

All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.


Primary
22
Additional
19
Reviews
6

Resources


© Stanford University, Stanford, CA 94305.