\r\nNew 305701 CAAAAAAAAAAAAACAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT 305760\r\n ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||\r\nOld 305698 CAAAAAAAAAAAA-CAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT 305756\r\n\r\nNew 305821 TATTGTATATTGAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT 305880\r\n ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||\r\nOld 305817 TATTGTATATTAAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT 305876\r\n\r\nNew 305881 TCTGTTTTTCAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA 305940\r\n ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||\r\nOld 305877 TCTTTTTTCAAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA 305936\r\n\r\nNew 305941 GAAAACTCTATCGATGTGATAATGTATGCCAATATCGGGACTGTACACCCACACATTTAC 306000\r\n ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||\r\nOld 305937 GAAAACTCTATCGATGTGATAATGTATGCCATTATCGGGACTGTACACCCACACATTTAC 305996", "date_created": "2011-02-15", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide insertion was made in the intergenic region between ORFs VTC1/YER072W and ALD5/YER073W.\r\n\r\nNew 303481 CCGTTTACACATCAATGATAAATAAGTATACAAAAAGGGTTCCATTTTTTTTTTTGGCCGCTACCGGACT 303550\r\n |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||\r\nOld 303479 CCGTTTACACATCAATGATAAATAAGTATACAAAAAGGGTTCCATTTTTTTTTT-GGCCGCTACCGGACT 303547", "date_created": "2011-02-15", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide substitution within the coding region of ALD5/YER073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 411 is now Glutamic Acid rather than Glycine.\r\nNew 305221 GGTTATTTTGTCAAGCCAACAGTGTTTGCTGATGTCAAAGAAGATATGAGAATTGTTAAG 305280\r\n |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||\r\nOld 305218 GGTTATTTTGTCAAGCCAACAGTGTTTGCTGATGTCAAAGGAGATATGAGAATTGTTAAG 305277\r\n", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []}, tabs: {"id": 1266807, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false} };ALD5 | SGD ALD5 / YER073W Overview
- Standard Name
- ALD5 1
- Systematic Name
- YER073W
- SGD ID
- SGD:S000000875
- Feature Type
- ORF , Verified
- Description
- Mitochondrial aldehyde dehydrogenase; involved in regulation or biosynthesis of electron transport chain components and acetate formation; activated by K+; utilizes NADP+ as the preferred coenzyme; constitutively expressed 1 2 3
- Name Description
- ALdehyde Dehydrogenase 1
- Comparative Info
Sequence Details Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.
Analyze Sequence
S288C only
BLASTN | BLASTP | Design Primers | Restriction Fragment Map | Restriction Fragment Sizes | Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi | BLASTP at NCBI | BLASTP vs. fungi
S288C vs. other strains
Protein Details Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Length (a.a.)
- 520
- Mol. Weight (Da)
- 56696.4
- Isoelectric Point
- 8.32
- Median Abundance (molecules/cell)
- 19764 +/- 10239
- Half-life (hr)
- 12.3
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all ALD5 alleles in SGD search
Gene Ontology Details Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Mitochondrial aldehyde dehydrogenase involved in acetate biosythesis
View computational annotations
Molecular Function
- Manually Curated
- enables aldehyde dehydrogenase (NAD+) activity (IDA)
- enables aldehyde dehydrogenase [NAD(P)+] activity (IDA)
Biological Process
- Manually Curated
- involved in acetate biosynthetic process (IMP)
Cellular Component
- Manually Curated
- located in mitochondrion (IDA, HDA)
Pathways
Phenotype Details Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.
- Summary
- Non-essential gene in reference strain S288C; null mutant is sensitive to acetate and shows reduced competitive fitness
Interaction Details Interaction
Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.
175 total interactions for 140 unique genes
Physical Interactions
- Affinity Capture-MS: 61
- Affinity Capture-RNA: 8
- Co-localization: 1
- Proximity Label-MS: 2
Genetic Interactions
- Dosage Lethality: 1
- Dosage Rescue: 1
- Negative Genetic: 82
- Phenotypic Enhancement: 4
- Positive Genetic: 10
- Synthetic Growth Defect: 2
- Synthetic Lethality: 1
- Synthetic Rescue: 2
Regulation Details Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Regulators
- 10
- Targets
- 0
Expression Details Expression
Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.
Summary Paragraph
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2009-08-14
Literature Details Literature
All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.
Resources