See More

Sphingolipids are essential components of the plasma membrane in all eukaryotic cells. S. cerevisiae cells make three complex sphingolipids: inositol-phosphoceramide (IPC), mannose-inositol-phosphoceramide (MIPC), and mannose-(inositol phosphate)2-ceramide (M(IP)2C)(5). In the yeast plasma membrane sphingolipids concentrate with ergosterol to form lipid rafts, specialized membrane microdomains implicated in a variety of cellular processes, including sorting of membrane proteins and lipids, as well as organizing and regulating signaling cascades (6). Intermediates in sphingolipid biosynthesis have been shown to play important roles as signaling molecules and growth regulators. Sphingolipid long chain bases (LCBs), dihydrosphingosine (DHS) and phytosphingosine (PHS), have been implicated as secondary messengers in signaling pathways that regulate the heat stress response (7, 8). Other intermediates, phytoceramide and long-chain base phosphates (LCBPs), have been shown to be components of the tightly-controlled ceramide/LCBP rheostat, which regulates cell growth (9). Since phosphoinositol-containing sphingolipids are unique to fungi, the sphingolipid biosynthesis pathway is considered a target for antifungal drugs (10, 11).", "date_edited": "2007-10-05"}, "literature_overview": {"primary_count": 15, "additional_count": 18, "review_count": 25, "go_count": 7, "phenotype_count": 1, "disease_count": 1, "interaction_count": 26, "regulation_count": 4, "ptm_count": 1, "funComplement_count": 2, "htp_count": 15, "total_count": 96}, "disease_overview": {"manual_disease_terms": [{"annotation_type": "manually curated", "qualifiers": [null], "term": {"link": "/disease/DOID:0080250", "display_name": "erythrokeratodermia variabilis et progressiva 4"}, "evidence_codes": [{"display_name": "ISS", "link": "http://wiki.geneontology.org/index.php/Inferred_from_Sequence_or_structural_Similarity_(ISS)"}, {"display_name": "IGI", "link": "http://wiki.geneontology.org/index.php/Inferred_from_Genetic_Interaction_(IGI)"}]}], "htp_disease_terms": [], "computational_annotation_count": 0, "date_last_reviewed": "2021-06-03", "paragraph": "Yeast TSC10 is homologous to human KDSR, and has been used to study recessive progressive symmetric erythrokeratoderma characterized by severe lesions of thick scaly skin on face and genitals and thickened, red, and scaly skin on hands and feet"}, "ecnumbers": [{"display_name": "1.1.1.102", "link": "/ecnumber/EC:1.1.1.102"}], "URS_ID": null, "main_strain": "S288C", "regulation_overview": {"regulator_count": 8, "target_count": 0}, "reference_mapping": {"600583": 1, "367127": 2, "511430": 3, "1911187": 4, "551297": 5, "536615": 6, "578574": 7, "561401": 8, "552458": 9, "606018": 10, "536612": 11}, "history": [{"category": "Name", "history_type": "LSP", "note": "Name: TSC10", "date_created": "2000-05-19", "references": [{"id": 600583, "display_name": "Beeler T, et al. (1998)", "citation": "Beeler T, et al. (1998) The Saccharomyces cerevisiae TSC10/YBR265w gene encoding 3-ketosphinganine reductase is identified in a screen for temperature-sensitive suppressors of the Ca2+-sensitive csg2Delta mutant. J Biol Chem 273(46):30688-94", "pubmed_id": 9804843, "link": "/reference/S000055689", "year": 1998, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1074/jbc.273.46.30688"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/9804843"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: A single nucleotide substitution within the coding region of TSC10/YBR265W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 255 is now Aspartic Acid rather than Glutamic Acid.

\r\nNew    739302  CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGATGACGTTTTTACAGAT  739361\r\n               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||\r\nOld    739297  CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGAAGACGTTTTTACAGAT  739356", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": []},
        tabs: {"id": 1266938, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": true}
    };


	
	
	
    
    
	
    TSC10 | SGD
    
	
	
	









	
	

TSC10 / YBR265W Overview


Standard Name
TSC10 1
Systematic Name
YBR265W
SGD ID
SGD:S000000469
Feature Type
ORF , Verified
Description
3-ketosphinganine reductase; catalyzes the second step in phytosphingosine synthesis; essential for growth in the absence of exogenous dihydrosphingosine or phytosphingosine; localized to lipid droplets; member of short chain dehydrogenase/reductase protein family; mutations in human homolog KDSR cause recessive progressive symmetric erythrokeratoderma 1 2 3 4
Name Description
Temperature-sensitive Suppressors of Csg2 mutants 1
Comparative Info
Sequence Details

Sequence

The S. cerevisiae Reference Genome sequence is derived from laboratory strain S288C. Download DNA or protein sequence, view genomic context and coordinates. Click "Sequence Details" to view all sequence information for this locus, including that for other strains.


Summary
TSC10/YBR265W is located on the right arm of chromosome II, coding sequence is 963 nucleotides long with 1 nonsynonymous SNP
Protein Details

Protein

Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.


Length (a.a.)
320
Mol. Weight (Da)
35968.9
Isoelectric Point
6.25
Median Abundance (molecules/cell)
2283 +/- 549
Half-life (hr)
4.4

Alleles

Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.


View all TSC10 alleles in SGD search

Gene Ontology Details

Gene Ontology

GO Annotations consist of four mandatory components: a gene product, a term from one of the three Gene Ontology (GO) controlled vocabularies (Molecular Function, Biological Process, and Cellular Component), a reference, and an evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view all GO information and evidence for this locus as well as biological processes it shares with other genes.


Summary
3-ketosphinganine reductase of the chemical reactions and pathways involving 3-keto-dihydrosphingosine; also involved in the formation of sphingolipids; localizes to lipid particles, endoplasmic reticulum, and outer membranes of mitochondria

View computational annotations

Molecular Function

Manually Curated

Biological Process

Manually Curated

Cellular Component

Manually Curated

Pathways


Phenotype Details

Phenotype

Phenotype annotations for a gene are curated single mutant phenotypes that require an observable (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background, and a reference. In addition, annotations are classified as classical genetics or high-throughput (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and additional details are provided. Click "Phenotype Details" to view all phenotype annotations and evidence for this locus as well as phenotypes it shares with other genes.


Summary
Essential gene in reference strain S288C; diploid heterozygous null mutant is sensitive to dihydromotuporamine C; in large-scale studies, repression confers lower competitive fitness, sensitivity to HU and MMS, and resistance to myriocin; diploid heterozygous null mutant is sensitive to a human cationic antimicrobial peptide
Disease Details

Disease

Disease Annotations consist of three mandatory components: a gene product, a term from the Disease Ontology (DO) controlled vocabulary and an evidence code. SGD provides manually curated DO Annotations derived from the literature. Click "Disease Details" to view all Disease information and evidence for this locus as well as diseases it shares with other genes.


Summary
Yeast TSC10 is homologous to human KDSR, and has been used to study recessive progressive symmetric erythrokeratoderma characterized by severe lesions of thick scaly skin on face and genitals and thickened, red, and scaly skin on hands and feet
Interaction Details

Interaction

Interaction annotations are curated by BioGRID and include physical or genetic interactions observed between at least two genes. An interaction annotation is composed of the interaction type, name of the interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a reference, as well as other experimental details. Click "Interaction Details" to view all interaction annotations and evidence for this locus, including an interaction visualization.


157 total interactions for 140 unique genes

Physical Interactions

  • Affinity Capture-MS: 7
  • Affinity Capture-RNA: 4
  • Biochemical Activity: 1
  • Co-localization: 1
  • Co-purification: 1
  • PCA: 1
  • Proximity Label-MS: 1
  • Reconstituted Complex: 1

Genetic Interactions

  • Dosage Growth Defect: 2
  • Negative Genetic: 108
  • Phenotypic Suppression: 1
  • Positive Genetic: 23
  • Synthetic Lethality: 5
  • Synthetic Rescue: 1
Regulation Details

Regulation

The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the given locus, based on experimental evidence. This evidence includes data generated through high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO enrichment among regulation Targets, and a regulator/target diagram for the locus.


Regulators
8
Targets
0
Expression Details

Expression

Expression data are derived from records contained in the Gene Expression Omnibus (GEO), and are first log2 transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result there may be a greater number of conditions than datasets represented in a single clickable histogram bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from those that are up-regulated (red). Click "Expression Details" to view all expression annotations and details for this locus, including a visualization of genes that share a similar expression pattern.


Summary Paragraph

A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links to gene names and curated GO terms are included within the Summary Paragraphs.


Last Updated: 2007-10-05

Literature Details

Literature

All manually curated literature for the specified gene, organized into topics according to their relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details" to view all literature information for this locus, including shared literature between genes.


Primary
15
Additional
18
Reviews
25

Resources


© Stanford University, Stanford, CA 94305.