\r\nNew: 166731 TTGTAAGGACAATATCATTTACGAATAATTTCATCCAATTG-TTTCATCAACACA 166784\r\n ||||||||||||||||||||||||||||||||||||||||| |||||||||||||\r\nOld: 166731 TTGTAAGGACAATATCATTTACGAATAATTTCATCCAATTGGTTTCATCAACACA 166785 ", "date_created": "2004-01-27", "references": [{"id": 551672, "display_name": "Kellis M, et al. (2003)", "citation": "Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54", "pubmed_id": 12748633, "link": "/reference/S000073327", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1038/nature01644"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12748633"}, {"display_name": "Reference supplement", "link": "http://www.nature.com/nature/journal/v423/n6937/suppinfo/nature01644.html"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Six separate single nucleotides were inserted within ORF BUD14/YAR014C, and three single nucleotide substitutions were also made, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now two amino acids longer and a small section of the protein sequence is now different. \r\n\r\nNew 167033 GTCAGTTTGATTTGCCATTCCTCCACTAGACCCCAAGCTGGCTTGAATTTGCCCCTCTGT 167092\r\n |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||\r\nOld 167034 GTCAGTTTGATTTGGCATTCCTCCACTAGACCCCAAGCTGGCTTGAATTTG-CCCTCTGT 167092\r\n\r\nNew 167093 GTTTTCCACGTTTGTTGTCTCTTCAATTTTCGATTTTGCATGAATATATTGTGAAATGTC 167152\r\n ||||||||||||||||||||| |||||||||||||||||||| ||||| |||| ||||||\r\nOld 167093 GTTTTCCACGTTTGTTGTCTC-TCAATTTTCGATTTTGCATG-ATATA-TGTG-AATGTC 167148\r\n\r\nNew 167153 CTTTATTGCTCTAGATGATGGAATACTGCTGCTTTCTTCAACTATTGGAGTGGATGGTGA 167212\r\n | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||\r\nOld 167149 C-TTATTGCTCTAGATGATGGAATACTGCTGCTTTCTTCAACTATTGGAGTGGATGGTGA 167207\r\n\r\nNew 167513 GACGTCGCTCACTACATCGCTCGTATCATCATCCTGGAATTTGCCAAAATTTAACTTCGC 167572\r\n ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||\r\nOld 167508 GACGTCGCTCACTACATCGCTCGTATCATCATCCTGGAATTTGGCAAAATTTAACTTCGC 167567\r\n\r\nNew 167763 TATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTTTGATTCTTGTTACCA 167822\r\n |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||\r\nOld 167758 TATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTCTGATTCTTGTTACCA 167817", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}], "complexes": [{"format_name": "CPX-1705", "display_name": "BUD14-GLC7 phosphatase complex"}, {"format_name": "CPX-36", "display_name": "Kelch-containing Formin Regulatory Complex"}]},
tabs: {"id": 1267623, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
};
BUD14 | SGD
BUD14 / YAR014C Overview
- Standard Name
- BUD14
1
- Systematic Name
- YAR014C
- SGD ID
- SGD:S000000069
- Feature Type
- ORF
, Verified
- Description
-
Protein phosphatase regulator; subunit of the Bud14p-Glc7p complex that localizes Glc7p to the cell cortex where it activates the dynein/dynactin complex; subunit of the KFRC complex with Kel1p and Kel2p that regulates Bnr1p (formin) to control actin cable assembly, cytokinesis, and polarized growth; involved in spindle pole body size maintenance; involved in bud-site selection; relative distribution to the nucleus increases upon DNA replication stress
1
2
3
4
5
6
- Name Description
- BUD site selection
1
- Comparative Info
-
Sequence Details
Sequence
The S. cerevisiae Reference Genome sequence is derived from laboratory strain
S288C. Download DNA or protein sequence, view genomic context and
coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
for other strains.
- Summary
- BUD14 is located on the right arm of chromosome I between TGA1 tRNA-Ala and ADE1 N-succinyl-5-aminoimidazole-4-carboxamide ribotide synthetase; coding sequence is 2130 nucleotides long with 10 nonsynonymous SNPs, 9 synonymous SNPs
Analyze Sequence
S288C only
BLASTN |
BLASTP |
Design Primers |
Restriction Fragment Map |
Restriction Fragment Sizes |
Six-Frame Translation
S288C vs. other species
BLASTN vs. fungi |
BLASTP at NCBI |
BLASTP vs. fungi
S288C vs. other strains
Protein Details
Protein
Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
- Summary
- Relative distribution to the nucleus increases upon DNA replication stress
- Length (a.a.)
- 709
- Mol. Weight (Da)
- 78899.8
- Isoelectric Point
- 4.1
- Median Abundance (molecules/cell)
- 3621 +/- 821
- Half-life (hr)
- 5.5
Alleles
Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.
View all BUD14 alleles in SGD search
Gene Ontology Details
Gene Ontology
GO Annotations consist of four mandatory components: a gene product, a term from one of the three
Gene Ontology (GO) controlled vocabularies
(Molecular Function,
Biological Process, and
Cellular Component), a reference, and an
evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
all GO information and evidence for this locus as well as biological processes it shares with other genes.
- Summary
- Protein phosphatase regulator involved in cytoskeleton organization, regulation of cytokinesis and vesicle-mediated transport, and transcriptional regulation; localizes to nucleus, cytoplasm, bud neck, bud tip, and incipient bud site; subunit of KFRC complex
View computational annotations
Molecular Function
- Manually Curated
-
enables
protein phosphatase regulator activity
(IMP,
IDA)
Biological Process
- Manually Curated
-
involved in
cytoskeleton organization
(IMP)
-
acts upstream of or within
mitotic spindle pole body organization
(IMP)
-
involved in
negative regulation of actin filament polymerization
(IGI,
IDA,
IMP)
-
involved in
negative regulation of exit from mitosis
(IMP)
-
involved in
regulation of cell shape
(IGI)
-
involved in
regulation of cytokinesis
(IGI)
-
involved in
regulation of DNA-templated transcription
(IMP,
IDA)
-
involved in
regulation of formin-nucleated actin cable assembly
(IGI)
-
involved in
regulation of protein localization
(IDA)
-
involved in
regulation of vesicle-mediated transport
(IMP)
Cellular Component
- Manually Curated
-
located in
cellular bud neck
(IDA)
-
located in
cellular bud tip
(IDA)
-
located in
cytoplasm
(HDA)
-
located in
incipient cellular bud site
(IDA)
-
part of
Kelch-containing formin regulatory complex
(IDA)
-
is active in
nucleus
(HDA)
Complex
Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.
Phenotype Details
Phenotype
Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
(e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
and a reference. In addition, annotations are classified as classical genetics or high-throughput
(e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
evidence for this locus as well as phenotypes it shares with other genes.
- Summary
- Non-essential gene in reference strain S288C; diploid null mutant displays aberrant random budding pattern and abnormal movement of secretory vesicles; null mutants in systematic studies show sensitivity to caffeine, camptothecin, cycloheximide, fluconazole, rapamycin, and resistance to hydroxyurea, tunicamycin
Classical Genetics
Large-scale Survey
- null
- budding pattern: abnormal
- cell shape: abnormal
- chemical compound accumulation: abnormal
- chemical compound accumulation: increased
- chronological lifespan: increased
- competitive fitness: decreased
- desiccation resistance: decreased
- filamentous growth: decreased
- haploproficient
- invasive growth: absent
- resistance to chemicals: decreased
- resistance to chemicals: increased
- resistance to chemicals: normal
- stress resistance: increased
- vegetative growth: decreased rate
- viable
- overexpression
Interaction Details
Interaction
Interaction annotations are curated by BioGRID and include physical
or genetic interactions observed
between at least two genes. An interaction annotation is composed of the interaction type, name of the
interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
reference, as well as other experimental details. Click "Interaction Details" to view all interaction
annotations and evidence for this locus, including an interaction visualization.
483 total interactions for 358 unique genes
Physical Interactions
- Affinity Capture-MS: 25
- Affinity Capture-RNA: 5
- Affinity Capture-Western: 2
- Biochemical Activity: 4
- Co-localization: 5
- PCA: 8
- Proximity Label-MS: 2
- Reconstituted Complex: 2
- Two-hybrid: 65
Genetic Interactions
- Dosage Lethality: 1
- Dosage Rescue: 1
- Negative Genetic: 254
- Phenotypic Enhancement: 3
- Phenotypic Suppression: 2
- Positive Genetic: 63
- Synthetic Growth Defect: 25
- Synthetic Lethality: 5
- Synthetic Rescue: 11
Regulation Details
Regulation
The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
given locus, based on experimental evidence. This evidence includes data generated through
high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
enrichment among regulation Targets, and a regulator/target diagram for the locus.
- Regulators
-
7
- Targets
-
0
Expression Details
Expression
Expression data are derived from records contained in the
Gene Expression Omnibus (GEO), and are first log2
transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
there may be a greater number of conditions than datasets represented in a single clickable histogram
bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
details for this locus, including a visualization of genes that share a similar expression pattern.
Summary Paragraph
A summary of the locus, written by SGD Biocurators following a thorough review of the literature. Links
to gene names and curated GO terms are included within the Summary Paragraphs.
Last Updated: 2005-09-26
Literature Details
Literature
All manually curated literature for the specified gene, organized into topics according to their
relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
to view all literature information for this locus, including shared literature between genes.
Resources