\r\n 
                The S. cerevisiae Reference Genome sequence is derived from laboratory strain
                S288C. Download DNA or protein sequence, view genomic context and
                coordinates. Click "Sequence Details" to view all sequence information for this locus, including that
                for other strains.
             
                            BLASTN | 
                        
                            
                            BLASTP | 
                        
                            
                            Design Primers | 
                        
                            
                            Restriction Fragment Map | 
                        
                            
                            Restriction Fragment Sizes | 
                        
                            
                            Six-Frame Translation  
                            BLASTN vs. fungi | 
                        
                            
                            BLASTP at NCBI | 
                        
                            
                            BLASTP vs. fungi  
       	       Basic sequence-derived (length, molecular weight, isoelectric point) and experimentally-determined (median abundance, median absolute deviation) protein information. Click "Protein Details" for further information about the protein such as half-life, abundance, domains, domains shared with other proteins, protein sequence retrieval for various strains, physico-chemical properties, protein modification sites, and external identifiers for the protein.
             
		Curated mutant alleles for the specified gene, listed alphabetically. Click on the allele name to open the allele page. Click "SGD search" to view all alleles in search results.                     
                 View all OAF1 alleles in SGD search
 
                GO Annotations consist of four mandatory components: a gene product, a term from one of the three
                Gene Ontology (GO) controlled vocabularies
                (Molecular Function,
                Biological Process, and
                Cellular Component), a reference, and an
                evidence code. SGD has manually curated and high-throughput GO Annotations, both derived from the
                literature, as well as computational, or predicted, annotations. Click "Gene Ontology Details" to view
                all GO information and evidence for this locus as well as biological processes it shares with other genes.
             View computational annotations 
		     Macromolecular complex annotations are imported from the Complex Portal. These annotations have been derived from physical molecular interaction evidence extracted from the literature and cross-referenced in the entry, or by curator inference from information on homologs in closely related species or by inference from scientific background.
	         
                Phenotype annotations for a gene are curated single mutant phenotypes that require an observable
                (e.g., "cell shape"), a qualifier (e.g., "abnormal"), a mutant type (e.g., null), strain background,
                and a reference. In addition, annotations are classified as classical genetics or high-throughput
                (e.g., large scale survey, systematic mutation set). Whenever possible, allele information and
                additional details are provided. Click "Phenotype Details" to view all phenotype annotations and
                evidence for this locus as well as phenotypes it shares with other genes.
             
                Interaction annotations are curated by BioGRID and include physical
                or genetic interactions observed
                between at least two genes. An interaction annotation is composed of the interaction type, name of the
                interactor, assay type (e.g., Two-Hybrid), annotation type (e.g., manual or high-throughput), and a
                reference, as well as other experimental details. Click "Interaction Details" to view all interaction
                annotations and evidence for this locus, including an interaction visualization.
             103 total interactions for 87 unique genes 
                The number of putative Regulators (genes that regulate it) and Targets (genes it regulates) for the
                given locus, based on experimental evidence. This evidence includes data generated through
                high-throughput techniques. Click "Regulation Details" to view all regulation annotations, shared GO
                enrichment among regulation Targets, and a regulator/target diagram for the locus.
             
                Expression data are derived from records contained in the
                Gene Expression Omnibus (GEO), and are first log2
                transformed and normalized. Referenced datasets may contain one or more condition(s), and as a result
                there may be a greater number of conditions than datasets represented in a single clickable histogram
                bar. The histogram division at 0.0 separates the down-regulated (green) conditions and datasets from
                those that are up-regulated (red). Click "Expression Details" to view all expression annotations and
                details for this locus, including a visualization of genes that share a similar expression pattern.
             
                All manually curated literature for the specified gene, organized into topics according to their
                relevance to the gene (Primary Literature, Additional Literature, or Review). Click "Literature Details"
                to view all literature information for this locus, including shared literature between genes.
            
YAL023C/PMT2 and YOR321W/PMT3\r\n
YAL028W/FRT2 and YOR324C/FRT1\r\n
YAL029C/MYO4 and YOR326W/MYO2\r\n
YAL030W/SNC1 and YOR327C/SNC2\r\n
YAL034C/FUN19 and YOR338W\r\n
YAL037W and YOR342C\r\n
YAL038W/CDC19 and YOR347C/PYK2\r\n
YAL051W/OAF1 and YOR363C/PIP2\r\n
YAL053W/FLC2 and YOR365C\r\n
YAL056W/GPB2 and YOR371C/GPB1\r\n
YAL062W/GDH3 and YOR375C/GDH1", "date_created": "2012-08-21", "references": [{"id": 526423, "display_name": "Byrne KP and Wolfe KH (2005)", "citation": "Byrne KP and Wolfe KH (2005) The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 15(10):1456-61", "pubmed_id": 16169922, "link": "/reference/S000113653", "year": 2005, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1101/gr.3672305"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1240090/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/16169922"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: Nucleotide changes within the coding region of OAF1/YAL051W  resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 70 is now Arginine rather than Tryptophan, residue 447 is now Glutamine rather than Proline, and residue 588 is now Lysine rather than Threonine.\r\nNew    48726   CATAATAGGAAAAGAAATAGAATATTGTTTGTCTGCCAGGCTTGTAGGAAGTCAAAAACA  48785\r\n               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||\r\nOld    48727   CATAATAGGAAAAGAAATAGAATATTGTTTGTCTGCCAGGCTTGTTGGAAGTCAAAAACA  48786\r\n\r\nNew    49856   AATAATTGATAAATACCCAATACCGAACGATTTTATTTTATTGAGTCAAAGATGTCTAGC  49915\r\n               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||\r\nOld    49857   AATAATTGATAAATACCCAATACCGAACGATTTTATTTTATTGAGTCCAAGATGTCTAGC  49916\r\n\r\nNew    50286   AACCGAGTTAGGGGCGATCTAAGCGATATCAATAATCACAAACTTTTGAGAATTCATAAA  50345\r\n               |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||\r\nOld    50287   AACCGAGTTAGGGGCGATCTAAGCGATATCAATAATCACACACTTTTGAGAATTCATAAA  50346", "date_created": "2011-02-03", "references": [{"id": 374815, "display_name": "Engel SR, et al. (2014)", "citation": "Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98", "pubmed_id": 24374639, "link": "/reference/S000156273", "year": 2014, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1534/g3.113.008995"}, {"display_name": "PMC full text", "link": "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3962479/"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/24374639"}]}]}, {"category": "Sequence change", "history_type": "SEQUENCE", "note": "Sequence change: The work of Kellis et al. 2003 predicted the deletion of 2 separate G nucleotides in YAL051W at chromosomal coordinates 51688 and 51694, and these sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YAL051W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 1062 to 1047 amino acids. NEW: 51666 TTTATTTGATTATGACTTTTTG-TTTGG-CAATGACTTTGCTTAAAAATTTTCTTTCCAA 51723\r\n           |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||\r\nOLD: 51666 TTTATTTGATTATGACTTTTTGGTTTGGGCAATGACTTTGCTTAAAAATTTTCTTTCCAA 51725 ", "date_created": "2004-07-20", "references": [{"id": 551672, "display_name": "Kellis M, et al. (2003)", "citation": "Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54", "pubmed_id": 12748633, "link": "/reference/S000073327", "year": 2003, "urls": [{"display_name": "DOI full text", "link": "http://dx.doi.org/10.1038/nature01644"}, {"display_name": "PubMed", "link": "http://www.ncbi.nlm.nih.gov/pubmed/12748633"}, {"display_name": "Reference supplement", "link": "http://www.nature.com/nature/journal/v423/n6937/suppinfo/nature01644.html"}]}]}], "complexes": [{"format_name": "CPX-1038", "display_name": "PIP2-OAF1 transcription factor complex"}]},
        tabs: {"id": 1268188, "protein_tab": true, "interaction_tab": true, "summary_tab": true, "go_tab": true, "sequence_section": true, "expression_tab": true, "phenotype_tab": true, "literature_tab": true, "wiki_tab": false, "regulation_tab": true, "sequence_tab": true, "history_tab": true, "homology_tab": true, "disease_tab": false}
    };
	
	
	
    
    
	
    OAF1 / YAL051W Overview
        
        
        
                
                
                    
 
		       
                    
                Sequence
            
            
	
        
                    
Analyze Sequence
                    S288C only
S288C vs. other species
 S288C vs. other strains
 
                        
                    Protein
            
            
	
                     
Alleles
                
                
	
Gene Ontology
            
            
        
                    
Molecular Function
                    
                        
                        
                            
                                
Biological Process
                    
                        
                        
                            
                                
Cellular Component
                    
                        
                        
                            
                                
Complex
		
                
	
	
    Phenotype
            
            
        
        Classical Genetics
                    
                
                        
Large-scale Survey
                        
                            
                                
                                     
Interaction
            
            
        
                    
Physical Interactions
                    
                        
                            
Genetic Interactions
                    
                        
                            
Regulation
            
            
	
        
                    
Expression
            
            
        Literature
            
            
        
    Resources