Summary
Nonsense mutations create premature termination codons (PTCs), activating the nonsense-mediated mRNA decay (NMD) pathway to degrade most PTC-containing mRNAs. The undegraded mRNA is translated, but translation terminates at the PTC, leading to no production of the full-length protein. This work presents targeted PTC pseudouridylation, an approach for nonsense suppression in human cells. Specifically, an artificial box H/ACA guide RNA designed to target the mRNA PTC can suppress both NMD and premature translation termination in various sequence contexts. Targeted pseudouridylation exhibits a level of suppression comparable to that of aminoglycoside antibiotic treatments. When targeted pseudouridylation is combined with antibiotic treatment, a much higher level of suppression is observed. Transfection of a disease model cell line (carrying a chromosomal PTC) with a designer guide RNA gene targeting the PTC also leads to nonsense suppression. Thus, targeted pseudouridylation is an RNA-directed gene-specific approach that suppresses NMD and concurrently promotes PTC read-through.
Graphical Abstract
eTOC Blurb
Adachi et al. have developed a new approach (targeted PTC pseudouridylation) to nonsense suppression. Targeted PTC pseudouridylation is achieved by introducing into cells a designer box H/ACA RNA targeting the mRNA PTC. Conversion of the uridine to pseudouridine at the PTC suppresses NMD and promotes PTC readthrough, restoring full-length protein.
Introduction
Many genetic diseases are caused by point mutations, of which about 10-20% are nonsense mutations1,2. Nonsense mutations convert a sense codon into a nonsense codon (stop codon; premature translation termination codon or PTC) in the coding region3. Nonsense mutations have been extensively studied, and it is becoming increasingly clear how nonsense mutations impact gene expression and cause diseases4,5. In general, a PTC-containing gene (resulting from nonsense mutation) is first transcribed into pre-mRNA. Introns are then removed from the pre-mRNA by splicing, and the exon-junction complexes (EJCs) are deposited onto the spliced mRNA. The EJCs are often critical to activating a quality control surveillance pathway, called nonsense-mediated mRNA decay (NMD), which degrades the PTC-containing mRNA6. Although a small percentage of the PTC-containing mRNA transcripts evade NMD and are translated into protein, the translation of these transcripts terminates pre-maturely at the PTC7. As a result, patients with genetic diseases resulting from nonsense mutations generally have no full-length functional gene product (protein) produced in their cells, leading to the most severe form of the disease8. Some well-known examples of these diseases (and their disease genes) include Cystic Fibrosis (CFTR gene)9, Duchenne Muscular Dystrophy (Dystrophin gene)10, Beta Thalassemia (β-Globin gene)11, Hurler Syndrome (IDUA gene)12, Neurofibromatosis 1 (NF1 gene)13, and many types of cancers (p53 gene)14,15.
To combat diseases caused by nonsense mutations in specific genes, considerable efforts have been directed at changing, at the RNA level (not at the DNA level), the PTC ribonucleotides within the disease mRNA, thereby converting the PTC back to a sense codon16. Prompted by this idea and the fact that the chemical properties of pseudouridine (Ψ) are distinct from that of uridine, we proposed a novel strategy, namely, RNA-guided RNA pseudouridylation (U-to-Ψ conversion)17,18, to target the uridine of a PTC, thereby suppressing NMD as well as promoting PTC-read-through to produce full-length functional protein in the cell (Fig 1A). Indeed, by converting the invariant U of a PTC into a Ψ, we observed significant nonsense read-through in yeast cells17,19. It appears that pseudouridylated nonsense codons are no longer recognized as stop codons by the translation machinery. Specifically, during translation, specific tRNAs, rather than the release factors, enter the ribosome and deliver their corresponding amino acids to the decoding center for peptide synthesis and consequent PTC read-through16. The coding specificity has been determined in yeast cells under the conditions tested. ΨGA predominantly codes for phenylalanine/tyrosine, whereas ΨAA and ΨAG primarily for threonine/serine17. It appears that this novel recoding is due to an unusual codon-anticodon base-pairing scheme at the ribosomal decoding center20. Importantly, because pseudouridylated PTCs are no longer read as stop codons, NMD is also expected to be inactivated to degrade the Ψ-PTC-containing mRNA. Although the observed NMD effect is small in yeast17,19, this quality control surveillance pathway (NMD) plays a significant role in human cells, and inactivating it is expected to lead to increased level of PTC-containing mRNA21,22.
Figure 1.
Nonsense suppression by targeted pseudouridylation. (A) Box H/ACA RNA-guided RNA pseudouridylation is diagramed on the left. Box H/ACA gRNA (black line) and the four common core proteins, Nhp2, Gar1, Nop10, and Cbf5 (Dyskerin/NAP57 in mammals), are shown, and they form the box H/ACA RNP complex. During pseudouridylation, the guide sequences of box H/ACA gRNA form base-pairing interactions with the substrate RNAs (red lines), specifying the target uridine to be pseudouridylated (Ψs, indicated by arrows). Nonsense suppression by targeted pseudouridylation is schematized on the right. Double-stranded DNA (with an open reading frame) is shown. A PTC created by a nonsense mutation and the normal stop codon are indicated. After transcription and processing, mRNA (red) is produced. Normally, the presence of the PTC triggers NMD, degrading the PTC-containing mRNA. A small fraction of PTC-containing mRNA escapes from NMD and is translated, but translation stops at the PTC. In the presence of a designer gRNA (with its guide sequence designed to target the uridine of the PTC), the target uridine is site-specifically converted into Ψ, leading to NMD suppression and PTC-readthrough (full-length proteins are restored). (B) Two gRNA expression plasmids are diagrammed. One contained an independent gRNA gene and the other contained a gRNA gene within the intron of a hybrid β-globin gene whose 5’ end sequence is altered (LINK). Both were under the control of the CMV promoter. (C) After transfection of cells with the independent gRNA plasmid (lane 1) or with the intronic gRNA plasmid (lane 2), total RNA was recovered and Northern analysis was carried out using a DNA oligonucleotide complementary to a specific sequence of the designer gRNA (upper panel). The mature gRNA is indicated. As a control, the RNA sample was also probed with anti-U6 DNA oligonucleotide (lower panel). (D) Pre-mRNA splicing and gRNA production was monitored by RT-PCR at different time points during cell culture. The β-globin pre-mRNA with an altered 5’ end sequence (the LINK sequence, see B) and the two pairs of primers (R1-F1 and R2-F2; except for R1, all the other primers are specific to the exogenously transfected β-globin gene) are shown schematically. At indicated time points post-transfection with the intron-encoded designer gRNA plasmid (see B), cells were collected, RNA recovered, and RT-PCR performed. Primer pairs R1-F1 and R2-F2 were used to detect pre-mRNA/mRNA and gRNA, respectively. ACTB mRNA was also measured by another pair of primers as a loading control. The asterisks indicate two bands whose identities are currently unknown. (E) The N-terminal FLAG-tagged β-Thalassemia (β-globin Q39X) pre-mRNA and mRNA are shown. The PTC (Q39X) and its flanking sequences are also shown. The three exons (E1, E2, and E3), two introns (black lines), and the FLAG tag are indicated. (F) After co-transfection of HEK293T cells with a plasmid containing an N-terminal FLAG-tagged β-Thalassemia (β-globin Q39X) gene (see E) and a plasmid encoding the gRNA (intron-encoded; see B and D) specific (lanes 3 and 4) or non-specific (lanes 1 and 2) for targeting the PTC, total RNA was recovered and pseudouridylation assay (CMC-modification followed by primer-extension) performed using a primer complementary to a short sequence of β-Thalassemia downstream of the PTC (upper panel). As a control, primer-extension was also performed with a primer complementary to U6 (lower panel). The image was cropped for alignment purpose (indicated by the line).
Targeting of nonsense codons in yeast was achieved by expressing a designer box H/ACA guide RNA (gRNA) capable of site-specifically directing the conversion of U to Ψ within the nonsense codon17-19,23,24. Box H/ACA gRNAs are a group of small RNAs, found in abundance in archaea and eukaryotes, that naturally direct pseudouridylation of rRNAs, snRNAs as well as mRNAs in eukaryotes, at specific sites25-28. Each box H/ACA gRNA exists as a ribonucleoprotein complex (box H/ACA RNP) with four common core proteins, including Nhp2, Nop10, Gar1, and the pseudouridylase Cbf5 (dyskerin or NAP57 in mammals) (Fig 1A). Although they have completely different sequences, eukaryotic box H/ACA RNAs all fold into a unique hairpin-hinge (box H)-hairpin-tail (box ACA) structure (Fig 1A). In each hairpin, there is an internal loop (pseudouridylation pocket), which functions as a guide by base-pairing with the RNA substrate. As a consequence of this base-pairing, the target uridine is precisely positioned at the base of the upper stem of the hairpin, and is pseudouridylated by Cbf5 (dyskerin/NAP57 in mammals) (Fig 1A)29. The unique base-pairing between the guide sequence and the substrate RNA (Fig 1A) can therefore be used for predicting the site of pseudouridylation27,30,31. It is important to note that box H/ACA RNAs are often encoded in the introns of Pol II transcripts in mammals (Fig 1B)32-35.
Here, we test our RNA-guided RNA pseudouridylation approach to suppressing disease mRNA nonsense mutations in human cells, including HEK293T cells and disease-relevant cells. Our results indicate that just as was observed in yeast17, targeted pseudouridylation (targeting PTC using designer box H/ACA gRNA) results in target-specific suppression of both NMD and translation termination at PTCs in human cells, leading to the restoration of full-length functional proteins.
Design
Our previous yeast results indicated that site-directed pseudouridylation at a PTC (the uridine of the codon) of an mRNA resulted in coding specificity change, converting the PTC back into a sense codon17. Consequently, both NMD and translation termination were suppressed. To apply this approach to mammalian cells (see Fig 1A), we first set out to test whether a similar designer box H/ACA gRNA can be efficiently expressed in mammalian cells. We constructed two versions of box H/ACA gRNA-expression plasmids (Fig 1B), both of which were based on the known mammalian box H/ACA RNA, pugU2-34/44 (with only the guide sequence altered to target a specific site)36. The first was similar to the yeast version previously described, where an independent gRNA gene was directly under the control of the CMV promoter (Pol II promoter). Unfortunately, our northern analysis showed that this construct did not produce a mature-sized gRNA (Fig 1C, lane 1). This is likely due to the 5’ m7G cap, introduced during Pol II transcription37, that blocked proper processing. The second version was derived from an existing β-globin plasmid (with three exons and two introns)34,38, where the gRNA gene was inserted into the first intron of the β-globin gene (Fig 1B, and see Materials and Methods). Upon transfection of this plasmid, cells expressed correctly-sized gRNA as judged by northern blot analysis (Fig 1C, lane 2).
To further understand the relationship between splicing and gRNA production, we performed RT-PCR to monitor β-globin pre-mRNA splicing and gRNA production at different time points post-transfection (Fig 1D). Pre-mRNA and mRNA (or splicing) were detected about 30 minutes-2 hours after transfection; spliced mRNA accumulated throughout the cell culture. Consistently, gRNA was also detected about 30 minutes-2 hours post-transfection and accumulated, just as the spliced mRNA did (lanes 4-6), suggesting that pre-mRNA splicing was accompanied by the synthesis of intron-encoded gRNA (as expected). Given these results, we decided to use the intron-encoded designer gRNA plasmid (intronic gRNA) for all following experiments.
Having the correctly-sized designer gRNA expressed, we next tested its pseudouridylation activity by co-transfecting Human Embryonic Kidney (HEK) 293 cells with two plasmids: one containing an N-terminal FLAG-tagged β-thalassemia gene (β-globin mutant) with a nonsense mutation at codon 39 (PTC39 or Q39X) (Fig 1E)39,40 and the other containing a gRNA gene with its guide sequence designed to specifically or non-specifically target the PTC at codon 39 (Q39X). To determine whether the target site (uridine of PTC39) of the β-thalassemia mRNA was pseudouridylated, we assayed pseudouridylation of β-thalassemia mRNA at the target site using the standard pseudouridylation assay, namely CMC-modification followed by alkaline hydrolysis and primer-extension41. Due to the formation of bulky CMC-Ψ adduct, primer-extension stops one nucleotide before the Ψ site.
As shown in Figure 1F, we detected the CMC-Ψ adduct in the β-thalassemia mRNA at the expected position when cells were co-transfected with the PTC-specific designer gRNA; and the CMC-Ψ signal appeared only when RNAs were treated with CMC (followed by alkaline hydrolysis) (compare lane 3 with lane 4). When cells were not co-transfected with the PTC-specific designer gRNA, we did not detect the CMC-Ψ adduct band, as expected (lanes 1 and 2). This result indicated that PTC-specific gRNA directed site-specific pseudouridylation at the target uridine.
Given that the protein components associated with the designer gRNA are the essential integrators of the box H/ACA RNPs known to modify rRNAs and snRNAs, over-expression of designer gRNA may sequester these proteins, thus impairing the assembly of the endogenous H/ACA RNPs and modification of their substrate RNAs. To address this possibility, we directly checked rRNA pseudouridylation at several sites before and after designer gRNA transfection. Our results showed unequivocally that rRNA pseudouridylation levels at these test sites did not change (Fig S1), indicating that box H/ACA RNP proteins are likely in great excess in eukaryotic cells23,24 and that the expression of a designer gRNA has no impact on the function of endogenous box H/ACA RNPs.
Results
Pseudouridylation targeting PTC results in nonsense suppression in human cells
Using this system, we next assayed whether targeted pseudouridylation at the PTC site resulted in nonsense suppression in human cells. Because nonsense suppression normally occurs at two different levels, mRNA decay (NMD) and premature translation termination at PTC42, we checked both NMD and PTC-read-through after co-transfection of HEK293T cells with the PTC-containing β-thalassemia gene and the PTC-specific or non-PTC-specific designer gRNA gene. As a control, we also transfected cells with the WT parental β-globin reporter gene containing no PTC. As expected, when HEK293T cells were transfected with a wild-type parental β-globin gene (without PTC) alone, the wild-type β-globin reporter was efficiently expressed, as high levels of both mRNA (Fig 2A, upper panel, lane 1) and protein (lower panel, lane 1) were detected. In contrast, when the PTC-containing β-globin gene (β-thalassemia gene with a PTC at codon 39) and a non-PTC-specific designer gRNA gene were co-transfected into HEK293T cells, we detected a very low level (~1% relative to the wild-type) of PTC-containing β-globin mRNA (Fig 2A, upper panel, lane 2) and no full-length β-globin protein (lower panel, lane 2). However, when a PTC-specific designer gRNA gene was co-transfected, the levels of both β-globin mRNA (Fig 2A, upper panel, lane 3) and full-length β-globin protein (lower panel, lane 3) were restored to ~10-12% and ~6-8% of the wild-type level, respectively (compare lane 3 with lane 1, and for detailed quantitation see Fig 2B). We also measured the level of designer gRNA expressed in the cell (Fig 2A, middle panel). As expected, no designer gRNA was detected when cells were not transfected with a gRNA-containing plasmid (middle panel, lane 1). However, gRNA was detected when cells were transfected with either a non-PTC-specific designer gRNA plasmid (middle panel, lane 2) or the plasmid containing a PTC-specific gRNA gene (middle panel, lane 3).
Figure 2.
Nonsense suppression of the β-Thalassemia gene by targeted pseudouridylation. (A) HEK293T cells were either transfected with a plasmid encoding N-terminal FLAG-tagged wild-type β-globin (lane 1) or co-transfected with a plasmid containing a N-terminal FLAG-tagged β-Thalassemia (β-globin Q39X) gene (see Fig 1E) and a plasmid encoding gRNA specific (lane 3) or non-specific (lane 2) for targeting the PTC. Cell lysates were prepared and anti-FLAG IP and western blotting conducted (Lower panel). Total RNA was also isolated from the lysates for RT-PCR analyses, measuring the levels of β-Thalassemia (β-globin) mRNA (Upper panel) and gRNA (middle panel). MUP served as a loading control for RT-PCR and Tubulin served as a loading control for western blot analysis. The image was cropped for alignment purpose. (B) Quantification of the levels of mRNA and full-length protein observed in (A). After normalization against the control mRNA (MUP), the relative β-Thalassemia mRNA level was calculated. Likewise, after normalization against the control protein (Tubulin), the relative restored full-length protein level was also calculated. All quantifications were based on three independent experiments (error bars indicate S.D.-and (*) represents P < 0.05 calculated by Student's t test.). (C) To compare targeted pseudouridylation with G418 treatment, HEK293T cells were transfected with a plasmid encoding N-terminal FLAG-tagged wild-type β-globin (lane 1) or co-transfected with a plasmid containing an N-terminal FLAG-tagged β-Thalassemia (β-globin Q39X/PTC39) gene and a plasmid encoding a non-PTC-specific gRNA (lane 2) or a PTC-specific gRNA (lane 3). In parallel, HEK293T cells were transfected with the plasmid containing the N-terminal tagged β-Thalassemia (β-globin Q39X) gene (see Fig 1E) and then incubated in a medium containing G418 (125 μg/mL) (lane 4). In another parallel experiment, HEK293T cells were co-transfected with the plasmid containing the N-terminal FLAG-tagged β-Thalassemia (β-globin Q39X/PTC39) gene and the plasmid encoding the non-PTC-specific gRNA and then incubated in a medium containing G418 (125 μg/mL) (lane 5). Western analysis (lower panel) and RT-PCR were conducted (upper panel) as in (A). The image was cropped for alignment purpose. (D) Quantitative analysis of the levels of mRNA and full-length protein observed in (C). Calculation/analysis was exactly as in (B).
Using mutational analysis, the guiding activity of the designer gRNA was further tested. Our results showed that a sufficient guide-substrate base-paring interaction (8 or more base-pairs) is necessary for the gRNA-mediated nonsense suppression (Fig S2), as expected 23,43.
Ψ-mediated nonsense suppression works co-operatively with the antibiotic approach
To generate a better assessment, we carried out parallel experiments to compare our nonsense suppression strategy with one of the currently available readthrough-promoting approaches, the antibiotics (G418) treatment44-46. HEK293T cells were either co-transfected with the β-thalassemia gene (PTC39) and the PTC-specific designer gRNA gene or transfected with the β-thalassemia gene (PTC39) only but incubated in media containing G41845. The levels of mRNA and full-length β-globin protein were measured and compared (Fig 2C). We observed a significant level of restoration of mRNA (~8-10%) and full-length protein (~6-8%) when treated with 125 μg/mL of G418 (lane 4)45. We also saw a slightly better restoration of mRNA and full-length protein when the PTC-specific designer gRNA was co-transfected (lane 3).
Interestingly, when the two approaches were combined — HEK293T cells were co-transfected with the β-thalassemia gene (PTC39) and the PTC-specific designer gRNA gene and then incubated in media containing 125 μg/mL of G418 — we observed a much higher suppressive effect on both NMD (~15-17%) and PTC translation termination (~12-15%) (lane 5). In fact, when compared to targeted pseudouridylation alone (Fig 2C, lane 3) or G418 treatment alone (lane 4), the combined approach nearly doubled the level of both mRNA and full-length protein (lane 5) (for quantification, see Fig 2D).
The effect of Ψ-mediated nonsense suppression is long-lasting in human cells
To assess the duration of the nonsense suppression effect, we performed a time course of targeted PTC-pseudouridylation. HEK293T cells were co-transfected with the β-thalassemia gene (PTC39) and the PTC-specific designer gRNA gene. At different time points post-transfection, we harvested cells, prepared the cell lysate, and measured the levels of mRNA and gRNAs by RT-PCR and full-length protein level by western blotting.
As shown in Figure 3A and quantified in 3B, we detected restoration of both mRNA level and full-length protein level throughout the time course (3 days, 8 days, 11 days, and 16 days post-transfection). The apparent lower restoration levels at the later time points (e.g., 11 days and 16 days) are due to the dilution effect on both reporter plasmid and gRNA plasmid where cells continued to grow during the time course of the experiments [cells were split (1:1) at day 8]. Given that the new cells were not transfected with the reporter and gRNA genes and that an equal number of cells were taken for analysis at each time point, the apparent weaker restoration is expected. Consistently, we detected a relatively big drop in the levels of mRNA, gRNA and full-length protein after cell split (after day 8); overall, there was a persistent correlation between the expression levels of reporter mRNA and gRNA and the restoration level of full-length protein over the course of cell culture (Fig 3A). These results suggest that PTC pseudouridylation directed by designer box H/ACA gRNA has a long-lasting effect, so long as the cells are transfected with the PTC-specific gRNA gene. This is not unforeseen given that box H/ACA RNAs, present as box H/ACA RNPs in the cell, have a long half-life and remain functional throughout cell life47,48.
Figure 3.
The persistent effect of targeted pseudouridylation on nonsense suppression. (A) HEK293T cells were transfected with a plasmid encoding N-terminal FLAG-tagged wild-type β-globin (lane 1) or co-transfected with a plasmid containing an N-terminal FLAG-tagged β-Thalassemia (β-globin Q39X/PTC39) gene and a plasmid encoding a non-PTC-specific gRNA (lanes 1, 3, 5 and 7) or a PTC-specific gRNA (lanes 2, 4, 6 and 8). At different time points/days post transfection (day 3, day 8, day 11 and day16, indicated above each lane), cell lysates were made (using equal number of cells), and anti-FLAG IP and western were performed as in Fig 2A (lower panel). Total RNA was also prepared for RT-PCR analysis (Upper panel) as in Fig 2A. ACTB mRNA and Tubulin served as controls for RT-PCR and western, respectively. The image was cropped for alignment purpose. (B) Quantitative analysis of the levels of mRNA, gRNAs and full-length protein observed in (A). Calculation/analysis was exactly as in Fig 2B.
Pseudouridylation-induced nonsense suppression occurs in various PTC contexts
To test nonsense suppression in different disease gene sequence contexts, we replaced the PTC (at position 39) and its flanking sequences (15 nucleotides on each side) of β-thalassemia reporter with those of CFTR (PTC at codon 542, i.e., G542X-UGA and its flanking sequences, 15 nucleotides each side; Fig 4A and Table S1) or those of IDUA (PTC W392X-UAG and its 15-nucleotide flanking sequences) (Fig 4A and Table S1), and carried out exactly the same analysis. Again, our results revealed a site-specific and sequence-specific suppression of both NMD and translation termination at the CFTR PTC (Figs 4B and 4C) or the IDUA PTC (Figs 4D and 4E). Specifically, restoration of mRNA (~10-12% of WT) and full-length protein (~6-8% of WT) was observed only when the CFTR PTC-specific gRNA (Fig 4B, lane 4), but not the IDUA PTC-specific gRNA (lane 3) or no gRNA (lane 2), was co-transfected with the CFTR PTC-containing reporter (compare lane 4 with lanes 2 and 3). Similarly, when HEK293T cells were co-transfected with the IDUA PTC-containing reporter and the IDUA PTC-specific gRNA, (Fig 4D, lane 3), we saw a significant rescue of mRNA (~10-12%) and full-length protein (~6-8%). When a non-PTC-specific gRNA (lane 4) or no gRNA (lane 2) was co-transfected, no rescue was detected.
Figure 4.
Nonsense suppression by targeted pseudouridylation in different sequence contexts. (A) β-Thalassemia (β-globin Q39X) mRNA is diagrammed. The N-terminal FLAG tag, exons 1, 2, 3 (E1, E2 and E3), and the normal stop codon are indicated. Q39X/PTC39 and its flanking sequences (Blue) were substituted with the CFTR (G542X) or IDUA (W392X) PTC and flanking sequences (Red). (B) HEK293T cells were transfected with a plasmid encoding N-terminal FLAG-tagged wild-type β-globin (lane 1) or a plasmid containing the CFTR PTC-substituted β-globin gene (lane 2), or co-transfected with the plasmid containing the CFTR PTC-substituted β-globin gene and a plasmid encoding a non-PTC-specific gRNA (lane 3) or a PTC-specific gRNA (lane 4). Cell lysates were made, and the levels of mRNA and full-length protein were measured, as in Fig 2A. The image was cropped for alignment purpose. (C) Quantitative analysis of the levels of mRNA and full-length protein observed in (B). Calculation/analysis was exactly as in Fig 2B. (D) Experiments were performed exactly as in (B), except that a plasmid containing the IDUA PTC-substituted (instead of CFTR PTC-substituted) β-globin gene was used. Co-transfection with this plasmid and a plasmid encoding a PTC-specific gRNA is shown in lane 3. The image was cropped for alignment purpose. (E) Quantitative analysis of the levels of mRNA and full-length protein observed in (D). Calculation/analysis was exactly as in Fig 2B. (F) HEK293T cells were transfected with a plasmid encoding CFTR N-terminal Binding Domain (NBD1, C-terminal FLAG-tagged and intronless) or co-transfected with a plasmid containing a PTC (G542X)-containing NBD1 gene (C-terminal FLAG-tagged and intronless) and a plasmid encoding a non-PTC-specific gRNA (lane 2) or a PTC-specific gRNA (lane 3). Cell lysates were made, and the levels of mRNA and full-length protein were measured, as in Fig 2A. (G) Quantitative analysis of the levels of mRNA and the full-length CFTR NBD1 protein observed in (F). Calculation/analysis was exactly as in Fig 2B. (H) Experiments were performed exactly as in (F), except that a plasmid containing an intronless, C-terminal FLAG-tagged, full-length wild-type or PTC (W392X)-containing IDUA gene (instead of the CFTR NBD1 gene) was used. The image was cropped for alignment purpose. (I) Quantitative analysis of the levels of mRNA and the full-length IDUA protein observed in (H). Calculation/analysis was exactly as in Fig 2B.
Likewise, we also changed the β-globin PTC and its flanking sequences (15 nucleotides on each side) with those of NF1 or p53 genes, or with three additional PTC contexts of CFTR. All three different types of stop codons, UGA, UAG and UAA, were represented in these PTC sequences. In each case, we observed suppression of NMD and translation termination at the PTCs, as both mRNA level and full-length protein level were increased once a PTC-specific designer gRNA was co-expressed (Fig S3 and Table S1). Again, because no increase in mRNA and full-length protein was observed when a non-PTC-specific designer gRNA was co-expressed, the nonsense suppression detected here appeared to be sequence- and site-specific.
Next, taking advantage of the availability of the wild-type and PTC (G542X)-containing Nucleotide-Binding Domain (NBD1) of CFTR gene (C-terminally FLAG-tagged and intron-less), we directly analyzed this PTC in its natural sequence contexts (no β-globin sequence) in human cells. Upon transfection of HEK293T cells with the NBD1 and gRNA genes, cell lysate was prepared and immunoprecipitated with anti-FLAG antibody. Precipitated CFTR NBD1 protein was blotted and analyzed by anti-NBD1 antibody. Total RNA was also isolated from a small fraction of the cell lysate and used for RT-PCR to measure NBD1 mRNA level. As shown in Figures 4F and 4G, when the wild-type NBD1 gene (with no PTC) was transfected, high levels of NBD1 mRNA and full-length NBD1 protein were detected (lane 1). However, when the PTC-containing NBD1 gene (G542X) and a non-PTC-specific gRNA gene were co-transfected, we detected a background level of full-length protein (Fig 4F, lane 2). In contrast, when the PTC-containing NBD1 gene (G542X mutant) was co-transfected with an NBD1 PTC-specific gRNA gene, we observed a significant rescue (~7-9%) of full-length CFTR NBD1 protein (lane 3). Interestingly, the PTC-containing NBD1 mRNA level was about the same regardless of co-transfection with PTC-specific or PTC-non-specific gRNA gene. The amount of PTC-containing mRNA was comparable to (slightly less than) that of the wild-type NBD1 mRNA (compare lanes 1, 2 and 3). However, this is not unexpected, given that most PTC-containing genes require introns (or splicing) to activate NMD49. Without intron (or without splicing), NMD was not activated to degrade PTC-containing mRNA, and thus no significant difference in mRNA level was observed.
We also carried out the exact same experiments using the wild-type and PTC (W392X)-containing full-length IDUA gene (intron-less) and obtained nearly identical results (Figs 4H and 4I). Specifically, we observed a significant rescue (~7-9%) of full-length IDUA protein when the PTC (W392X)-containing full-length IDUA gene was co-transfected with the PTC-specific gRNA gene (Fig 4H, compare lane 3 with lane 1). No full-length protein was restored when a non-PTC-specific gRNA was co-transfected (lane 2). Again, we did not detect significant changes in the mRNA level, likely due to the fact that the IDUA gene used here contained no introns.
To further assess the potential off-target effect (or to verify the target specificity), we carried out genome-wide mRNA Ψ mapping (using a modified version of Pseudo-seq25,50) before and after designer gRNA transfection. In doing so, we detected multiple previously-identified Ψs in mRNA (e.g. AK2, CCT7, MALAT1, RPL19, and TPI1). More importantly, we did not find significant differences in Ψs between cells before and after gRNA transfection, suggesting again that the gRNA strategy used here is highly sequence- and site-specific (Fig S5, Table S3).
Targeted pseudouridylation leads to nonsense suppression in disease cell models
All the foregoing experiments were carried out in the well-established cell line (HEK293T) using an exogenously transfected reporter (disease genes containing a PTC). To further test our targeted pseudouridylation approach, we took advantage of the availability of a cystic fibrosis model cell line, 16HBEge-G542X (16HBE14o-bronchial epithelial cells), which carries a PTC (G542X) in the endogenous (chromosomal) CFTR gene51. We transfected the 16HBEge-G542X cells with the plasmid containing the PTC-specific gRNA gene, and subsequently analyzed the effect of the gRNA on nonsense suppression.
Figure 5 shows the results. When the 16HBEge-G542X cells were transfected with a non-PTC-specific designer gRNA, no CFTR mRNA nor full-length CFTR protein was detected (Fig 5A, lane 3). In contrast, a fairly high level of CFTR mRNA and full-length CFTR protein was seen when the cells were transfected with a PTC-specific designer gRNA (lane 2). To determine the percentage of restoration, the wild-type 16HBEge cells (no PTC in the endogenous CFTR gene) were also analyzed (lane 1). The results indicated that the restoration of mRNA and full-length protein by PTC-specific gRNA was about ~9-12% and ~6-8%, respectively (Fig 5B). We note that there are two major forms of CFTR protein expressed in 16HBEge cells, B-band and C-band, representing the immature core glycosylated full-length endoplasmic reticulum-form and terminally glycosylated full-length Golgi-processed form, respectively51.
Figure 5.
Nonsense suppression by targeted pseudouridylation in a disease model cell lines. (A) The 16HBE14o- human bronchial epithelial cell line, carrying a wild-type CFTR gene (lane 1) or a chromosomal PTC (G542X)-containing CFTR gene (lanes 2 and 3), was transfected with no plasmid (lane 1) or a plasmid encoding a PTC-specific (lane 2) or non-PTC-specific (lane 3) gRNA. Cells were harvested and cell lysates prepared. Total RNA was recovered and RT-PCR performed to measure the level of CFTR mRNA (wild-type or PTC mutant) (Upper panel). The lysates were also used for western analysis to measure the full-length CFTR protein (using anti-CFTR antibody) (Lower panel). ACTB mRNA and Tubulin served as a control for RT-PCR and western, respectively. Two forms of CFTR full-length protein (Band B and Band C) are indicated. (B) Quantitative analysis of the levels of CFTR mRNA and full-length CFTR protein observed in (A). Calculation/analysis was exactly as in Fig 2B. (C) The mouse embryonic fibroblasts carrying an endogenous PTC-containing IDUA gene (W392X) was also used for the nonsense suppression assay. Cells were transfected with a plasmid containing a non-PTC-specific gRNA gene (lane 2), a plasmid containing a PTC-specific gRNA gene (lane 3), or treated with G418 (250 μg/mL) (lane 4). As a control, wild-type mouse embryonic fibroblasts were also analyzed in parallel (lane 1). RT-PCR (upper panel) and western analysis (Lower panel) were performed as in Fig 2A except that different primers and anti-IDUA antibody were used. The image was cropped for alignment purpose. (D) Quantitative analysis of the levels of IDUA mRNA and full-length IDUA protein observed in (C). Calculation/analysis was exactly as in Fig 2B.
Likewise, we carried out nonsense suppression experiments in the mouse embryonic fibroblasts derived from homozygous C57BL/6-based mice with the mIDUA-W392X nonsense mutation. Because the mouse cell fibroblasts carry the chromosomal W392X nonsense mutation, we only transfected a gRNA gene (PTC-specific or non-PTC-specific) and analyzed the levels of IDUA mRNA and full-length protein (Figs 5C and 5D). Again, we detected a recovery (~10%) in the mRNA and protein levels when the β-globin gene carrying a PTC-specific gRNA was transfected (lane 3). This level of rescue is comparable to results of G418 treatment (250 μg/mL) (lane 4). Importantly, there is only a background level of restoration when the β-globin gene carrying a non-PTC-specific gRNA was transfected (lane 2), indicating again that gRNA-mediated nonsense suppression is PTC sequence-specific.
An artificial gRNA intron created in the mCherry gene also leads to nonsense suppression
To test whether the nonsense suppression by intron-encoded gRNA can be generalized, we generated another gRNA-expression plasmid (independent of the above β-globin-based vector/plasmid). We first inserted the gRNA gene as an intron (Table S2) into the mCherry gene. The new mCherry gene (containing the gRNA gene in the newly created intron) was then subcloned into an AAV plasmid (pAAV). The ability of this gRNA expression AAV plasmid to suppress nonsense mutations was then tested in parallel with the above β-globin plasmid (see Fig 1).
Upon co-transfection into the HEK293T cells with a PTC-containing reporter gene and the mCherry pAAV (encoding a gRNA in the newly created intron) or the β-globin plasmid (encoding a gRNA in its first intron), gRNA production and nonsense suppression, including measuring the levels of gRNA, mRNA, and the PTC-read-through full-length protein, were analyzed. Because removal of the gRNA-intron (splicing) is necessary to generate the mature mCherry mRNA and gRNA, the mCherry fluorescence signal should reflect the level of gRNA. As shown in Fig 6C, we detected strong mCherry fluorescence after transfection. Further analysis using RT-PCR detected a high level of gRNA, which was comparable to the gRNA level generated from the β-globin plasmid (Fig 6A, compare lane 3 with lane 4). Using RT-PCR and western blot, we also measured the levels of the reporter mRNA and PTC-read-through full-length reporter protein, respectively. As expected, similar levels of the reporter mRNA and full-length reporter protein were produced, regardless of which intron-encoded gRNA plasmid was used (β-globin plasmid or mCherry plasmid) (Figs 6A and 6B). These results indicated that the gRNA was effectively expressed upon transfection of an intron-encoded gRNA gene (either β-globin or mCherry). In addition, our results also showed that the gRNA, if PTC-specific, led to nonsense suppression.
Figure 6.
Nonsense suppression by an mCherry gene carrying an artificial intron that encodes a gRNA. (A) An artificial gRNA intron was inserted into the mCherry gene. HEK293T cells were transfected with the wild-type β-globin gene (without gRNA) (lane 1), or co-transfected with the mutant β-globin (with CFTR PTC, G542X) gene and an mCherry gene containing a non-PTC specific gRNA intron (lane 2) or a PTC-specific gRNA intron (lane 3). For direct comparison, cells were also co-transfected with the mutant β-globin (with CFTR PTC, G542X) gene and the β-globin gene carrying a PTC-specific gRNA in its first intron (used in all above experiments) (lane 4). RT-PCR and western analysis were performed as in Fig 2A. (B) Quantitative analysis of the levels of β-globin mRNA (with CFTR PTC), gRNA, and full-length β-globin protein (with G542X) observed in (A). Calculation/analysis was exactly as in Fig 2B. (C) mCherry fluorescence was detected in the cells transfected with the mCherry gene carrying an artificial (non-PTC-specific or PTC-specific) gRNA intron (first two rows), but not in the cells transfected with the β-globin gene carrying a gRNA intron (the bottom row).
Restored full-length IDUA protein is functional
Depending on what codon the PTC is originated from and what amino acid(s) the pseudouridylated PTC codes for, a restored full-length protein could carry a mutation at the PTC codon, i.e., an amino acid that is different from the original amino acid could be incorporated at the pseudouridylated PTC codon. Thus, it is critical to examine the function of the restored full-length protein.
To test the function of a restored full-length protein, we chose IDUA among all disease genes (and their PTC sequences) tested here. The IDUA PTC (W392X) is located at codon 392, which is originated from a tryptophan codon (from TGG to TAG). Based on our previous yeast results (although the coding specificity in yeast could be different from that in mammalian cells), ΨAG codes for Serine/Threonine, and therefore there could be a mutation at this PTC site. It is thus important to know whether the restored full-length IDUA protein is functional. The IDUA gene encodes α-L-iduronidase, an enzyme that hydrolyzes 4-methyl umbelliferyl-α-L-idopyranosiduronic acid 2-sulfate (IdoA2S-4MU). As a consequence of the hydrolysis, 4-methyl-umbelliferone (4MU), a fluorescent product, is released and can be detected/measured (see Fig 7A)52,53.
Figure 7.
IDUA protein functional assay. (A) The IDUA gene encodes α-L-iduronidase, an enzyme that hydrolyzes 4MU-iduronide, releasing fluorescent 4MU (schematized). (B) Cell culture and cell transfection were conducted as in Fig 4H. Cell lysates, prepared from HEK293T cells transfected with a plasmid carrying a PTC (W392X)-containing IDUA gene (Sample #1) or co-transfected with this plasmid and a plasmid encoding a non-PTC-specific gRNA (Sample #2) or a PTC-specific gRNA (Sample #3), were used for the IDUA functional assay. The standard curve was also carried out and shown (the left graph). The IDUA activity value of Sample #3 was within the linear range of standard curve. The graph shown on the right is an excerpt (of the graph shown on the left) focusing on the three experimental samples. (C) The IDUA functional assay was also carried out using cell lysates prepared from transfected mouse embryonic fibroblasts carrying an endogenous PTC-containing IDUA gene (W392X) (see Fig 5C). Sample #1 was from cells transfected with a plasmid containing a non-PTC-specific gRNA gene; Sample #2 was from cells transfected with a plasmid containing a PTC-specific gRNA gene; Sample #3 was from cells treated with G418 (250 μg/mL).
Cell lysates were prepared from HEK293T cells transfected with the IDUA PTC (W392X) gene and gRNA gene (see Figs 4H and 4I). As shown in Figure 7B, while the controls [HEK293T cells transfected with the IDUA PTC (W392X) gene alone (Sample #1) or co-transfected with a non-PTC-specific designer gRNA (Sample #2)] showed a background level of enzymatic activity, the experimental sample, derived from HEK293T cells co-transfected with the IDUA PTC (W392X) gene and the PTC-specific designer gRNA gene, showed significant α-L-iduronidase activity (Sample #3). These results indicate that the restored full-length IDUA protein is functional.
We also measured IDUA enzymatic activity using the cell lysates prepared from gRNA-transfected mouse embryonic fibroblasts derived from homozygous C57BL/6-based mice with the mIDUA-W392X nonsense mutation (see Figs 5C and 5D). As shown in Fig 7C, transfection of the PTC-specific gRNA gene resulted in an ~8-fold increase (or above the background level) in IDUA activity as compared to the control where a non-PTC-specific gRNA gene was transfected (compared Sample #2 with Sample #1). The IDUA enzymatic activity restored by the transfection of the PTC-specific gRNA gene was comparable to (if not better than) the restoration by treating cells with 250 μg/mL of G418 (compare Sample #2 with Sample #3).
DISCUSSION
In this work, we showed that we can design an artificial gRNA, based on a naturally-occurring box H/ACA RNA (only the guide sequence was altered to target a new substrate), to direct site-specific pseudouridylation at a PTC of a disease mRNA in human cells, resulting in both NMD suppression and PTC-read-through. We tested many different PTCs in various disease gene sequence contexts, and obtained similar and consistent results.
We also showed that our targeted pseudouridylation approach can be applied directly to the 16HBE14o-Human Bronchial Epithelial (HBE) cell line harboring a PTC (G542X) in the endogenous CFTR gene51. Site-specific targeting at the PTC (the uridine of the stop codon UGA) again led to NMD suppression and PTC read-through, restoring the production of full-length CFTR protein (~7%). Further, we were able to restore functional full-length protein from PTC-containing disease gene, IDUA (W392X).
Overall, our experiments have demonstrated the promising nature of this method in suppressing nonsense mutations, and we believe that it has great potential to combat human diseases caused by nonsense mutations.
Expression of mature, functional designer box H/ACA RNAs
We showed that we were able to produce a mature, functional designer box H/ACA RNA simply by placing the gRNA gene in an intron of a gene . This is not surprising, given that box H/ACA RNAs are intron-encoded33,35,54. Interestingly, however, we also showed that a designer gRNA gene, on its own as an independent Pol II transcription unit, was not properly processed into mature gRNA in human cells (although transcribed). This is in stark contrast to the yeast system, where a designer box H/ACA gRNA gene can be independently transcribed by Pol II and properly processed into mature gRNA17,19,55. The mechanistic difference between the two systems in processing box H/ACA RNA is not clear. However, it has been shown that a 5’ uncapped box H/ACA RNA, when injected into Xenopus oocytes (a vertebrate system believed to be similar to the human system), can be properly processed36. Together, these results suggest that the 5’-m7G cap structure, which is added during Pol II transcription in the cell, might present a problem for the processing and maturation of box H/ACA RNA in human cells. The m7G cap likely prevents the 5’−>3’ exonuclease from removing the 5’ extended precursor sequence, thus blocking box H/ACA RNA maturation in human cells. In yeast, it is known that endonucleases also participate in the maturation process56. Therefore, the box H/ACA RNA precursor, whether capped or uncapped, is properly processed into mature box H/ACA RNA in yeast cells.
To avoid the 5’ m7G cap problem in human cells, one can probably put the designer box H/ACA gRNA gene under the control of a Pol I or Pol III promoter — The Pol I or Pol III transcripts do not have a 5’ m7G cap57. However, to fully understand the mechanism of box H/ACA RNA processing, further work is necessary.
Target specificity
When compared with other nonsense suppression approaches, targeted pseudouridylation has a clear key advantage: high target specificity at both the NMD level and the level of translation termination. Indeed, designer gRNA-directed pseudouridylation has been proven, over the years, to be extremely site-specific19,23,24,26,43,54,58,59. We were able to engineer the guide sequence of box H/ACA RNA to target a PTC site, and only that site, within the mutant mRNA. In theory, no other sites, including all the normal stop codons present in every gene, will be modified. Thus, when applied to patients, no or minimal unwanted side effects are expected. Transcriptome-wide Pseudo-seq suggests that our approach has no significant off-target problem since there was no significant differences in pseudouridines comparing mRNA isolated from cells before and after (or with and without) transfection of a β-thalassemia PTC-specific gRNA. That said, caution should be taken in each case, because each gRNA has a unique guide sequence and the minimum base-pairing interactions (~8 base-pairs) 23,43 between each unique guide sequence and the substrate sequence may not be sufficient to confer absolute specificity. This is especially possible given that some sub-optimal base-pairing interactions (fewer base-pairs, wobble pairs, discontinuous base-pairs, etc.) may still allow low level of modification at some off-target sites. To unambiguously address this issue, pseudo-seq validation would be needed for each gRNA.. It should be pointed out that even if there are some off-targets that fall at the mRNA sense codons (U-containing codons), the effect would be minimal because pseudouridylated sense codons do not significantly change their coding specificities60.
Coding specificity
We showed that upon PTC pseudouridylation, full-length proteins were restored in human cells, suggesting that the pseudouridylated PTC (stop codon) codes for specific amino acid(s). This is not surprising given that we have previously shown similar results in yeast cells. Specifically, under the culturing conditions used, ΨAA and ΨAG both code for Serine and Threonine, and ΨGA codes for Tyrosine and Phenylalanine17. However, what the pseudouridylated stop codons code for is not well studied in mammalian cells and needs further investigation.
The fact that pseudouridylated PTCs code for specific amino acids raises an interesting question of whether the restored full-length protein is a wild-type protein and functional. It is possible that a nonsense codon is converted back to its original sense codon, and the restored full-length protein should be fully functional. On the other hand, if a pseudouridylated nonsense codon fails to match the amino acid (or tRNA) coded for by its original sense codon, the restored full-length protein would carry a single amino acid mutation at the PTC site. In this scenario, although not ideal, the full-length mutant protein could still be fully functional61. We have also demonstrated that the restored full-length IDUA protein (which could very possibly carry a point mutation at the PTC site) is indeed functional. Further, it has been shown that the mutant CFTR protein carrying a mis-sense mutation at codon 542 (G542R) (the exact same position as the PTC/nonsense mutation G542X analyzed in this work) exhibits a significant level of CFTR activity (~70%) when compared to WT CFTR62. In any case, the restored full-length proteins should be assessed on a case-by-case basis.
Additional benefits
Besides the target specificity and coding specificity discussed above, there are additional benefits for the gRNA-directed pseudouridylation approach. Box H/ACA RNPs (box H/ACA RNAs complexed with four core proteins) are necessary for rRNA/ribosome biogenesis and are expressed in all eukaryotic cells and tissues47,63. Thus, our approach has an additional advantage, i.e., expression of a designer gRNA alone is sufficient; nothing else needs to be co-expressed/delivered. The expressed designer gRNA efficiently complexes with the four endogenous core proteins to form functional box H/ACA RNP19,36,55. Because these core proteins are in great excess in eukaryotic cells23,24, they will not be sequestered by the expression or even over-expression of a designer gRNA. Therefore, the assembly/function of endogenous box H/ACA RNPs will not be affected.
It is well established that box H/ACA RNPs are highly stable and have a long half-life in the cell47,48. Therefore, it is expected that the designer gRNAs (box H/ACA RNAs) will behave similarly once they are expressed and assembled into box H/ACA RNPs in the cell. Indeed, we observed a long-lasting effect of a designer box H/ACA gRNA on nonsense suppression (16 days and beyond). From a clinical perspective, the long-lasting effect is highly valuable because this would permit infrequent dosing (gRNA as a drug), especially in the context of nondividing cells such as in the corneal epithelium64, photoreceptors65, heart muscle cells66 and neurons67.
Limitations
The main limitation of the current approach is its relatively low efficiency. Indeed, although comparable to the G418 treatment, the efficiency of nonsense suppression mediated by targeted pseudouridylation was relatively low, ranging roughly from ~2% to 10%. This is due, at least in part, to the fact that box H/ACA RNPs (including natural and designer box H/ACA gRNPs) are primarily localized to the nucleoli and Cajal bodies and are scarce in the nucleoplasm, where pre-mRNA/mRNA transiently resides and where mRNA pseudouridylation occurs. As a result, targeted mRNA modification is not optimal, resulting in a low level of pseudouridylation at the mRNA PTC. Therefore, increasing the concentration of designer gRNP in the nucleoplasm might be critical to improving the efficiency of nonsense suppression. One potential solution is to overexpress a designer gRNA, forcing it to form a competent designer box H/ACA gRNP (box H/ACA RNP proteins are in excess in the cell) and to be distributed to the nucleoplasm. On the other hand, there are at least three important sequence elements to consider when designing a box H/ACA gRNA (see Discussion above and 23,43). Doing so will likely increase the guiding activity of a designer gRNA, thus improving targeted mRNA pseudouridylation. More work is necessary.
While improvement of nonsense suppression efficiency is desirable, it should be pointed out that for many nonsense mutation-associated diseases, a small level (even 1%) of recovery of full-length protein is usually sufficient to generate a noticeable impact on the disease68. Therefore, the level of restoration by targeted pseudouridylation should be considered significant. We believe that with further optimization or in combination with other approaches, it is possible to reach an even higher level of nonsense suppression.
STAR★Methods
RESOURCE AVAILABILITY
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Yi-Tao Yu ([email protected])
Materials availability
This study did not generate new unique reagents. All reagents and kits used in this study are described in the STAR Methods.
Data and code availability
Pseudo-seq data have been deposited in NCBI's Gene Expression Omnibus69 and are accessible through GEO Series accession number GSE221516 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE221516).
The software has been deposited into GitHub, and a Zenodo repository created. This DOI allows access to the software: DOI: 10.5281/zenodo.7460422.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Cell culture
HEK293T cells and mouse embryonic fibroblasts that were derived from homozygous C57BL/6-based animals with the mIDUA-W392X mutation (MEF-cDNA)70 were cultivated in DMEM (Gibco) containing 10% fetal bovine serum (Gibco) under 5% CO2 at 37°C. When the confluency reaches to 90-100%, cells were passaged after washing with PBS followed by trypsin (Gibco) treatment at 37°C for 3 min. CFF-16HBE-G542X cell line was created by Cystic Fibrosis Foundation Therapeutics Lab51. This cell line was cultivated in Minimum Essential Medium (GIBCO) with 10% FBS and Penicillin/Streptmycin (GIBCO) using a coated dish by coating solution (LHC-8 basal medium (Gibco) with 0.01% BSA, x1/100 diluted Bovine collagen solution (Advanced BioMarix), and 10 μg/mL of Fironectin (Thermo Fisher Scientific). Cell passage was performed in the same way as for the other cell lines except that 10 min of trypsin treatment.
METHOD DETAILS
Plasmid construction and cell transfection
Using site-directed mutagenesis with PfuUltra II Fusion High-Fidelity DNA polymerase (Agilent) and the parental plasmid containing the human β-thalassemia gene (with unique linker sequences), pFLAG2CMV2-HBB (GL39ter) (gift from Dr. Lynne Maquat)40, we prepared various human β-globin-based substrate plasmids (reporters). The oligo pairs named “SDM-GL39-SWAPto-X (where X is the PTC-containing gene’s name) were used to follow the standard QuikChange protocol (Agilent). To generate a gRNA-expression plasmid, the gRNA gene was substituted for part of Intron1 (between exon 1 and exon 2) of the β-globin gene contained in a β-globin plasmid, pdRLuc-Gl (gift from Dr. Lynne Maquat)38, where Exon 1 and Intron 1 are derived from the human gene and Exon 2, Intron 2, and Exon 3 are from the mouse gene (human/mouse hybrid β-globin). Specifically, SalI and PstI restriction sites were introduced into the original Intron 1 (SalI is placed close to the 5’ end of intron, and PstI is near the 3’ end of the intron) by site-directed mutagenesis using two oligos, SDM1 and 2-GLintron1-Sal-Pst, and PfuUltra II Fusion High-Fidelity DNA polymerase (Agilent) according to the manufacturer’s protocol. Because pdRluc-Gl contains an extra PstI site, the SalI-HindIII-digested fragment of pdRluc-Gl (which covers the newly introduced SalI-PstI sequence) was cloned into YEplac195 to avoid digesting the extra PstI site of pdRluc-Gl. A synthetic gRNA gene sandwiched by the SalI and PstI sites was first inserted into the SalI-PstI -digested YEplac195, and then the SalI-HindIII fragment of YEplac195 containing the gRNA gene was cloned back into pdRluc-Gl plasmid, generating the gRNA expression plasmids. The procedure to produce the gRNA fragment is exactly the same as previously described17,55. Briefly, four overlapping oligos, F1, R1, R2, and R3 were amplified by Q5 High-Fidelity DNA Polymerase (NEB) where F1 contains SalI and R3 contains PstI restriction site, respectively, and the full-length guide RNA fragment was cloned as described above. F1, R1, and R2 oligos were different according to the target gene (while R3 is shared). The partial sequence of the gRNA gene designed to target the CFTR (G542X)-PTC is shown in Table S2. The guide sequences were changed depending on the substrate (or target) sequences (Table S1). [Note, Given the sequence differences, the specific primers used for reverse transcription and PCR can distinguish the human β-globin mRNA reporter (derived from pFLAG2CMV2-HBB; see Fig 1E) from the human/mouse hybrid β-globin mRNA38 (derived from pdRLuc-Gl; see Fig 1B) and from the endogenous β-globin mRNA.]
To construct another independent plasmid expressing any of the designer gRNAs used in this study (e.g., targeting CFTR at G542X), we created an artificial gRNA-intron (Table S2) in the mCherry gene. This intron-containing mCherry gene (mCherry-HSPA5intron-pugCFTR) was synthesized by gBlocks Gene Fragments from IDT (the entire sequence is shown in Table S2) and subcloned into the pAAV plasmid at the SacI-XbaI restriction sites, generating a new plasmid encoding the gRNA in the mCherry intron (mCherry-based AAV plasmid).
For the plasmid containing an independent (non-intronic) gRNA gene, the gRNA sequence was inserted into pcDNA3.1/Zeo(+) (Invitrogen) using three oligos, pugU2-GL39terF1HindIII, pugU2-GL39terR1, and pugU2-GL39terR2BamHI. The gRNA fragment was produced as described above, and HindIII and BamHI restriction sites of pcDNA3.1/Zeo(+) were used here. gRNA expression was directly under the control of the CMV promoter.
HEK293T cells were transfected with plasmid DNA that was extracted with GeneJET Plasmid Midiprep Kit (Thermo Fisher Scientific) using Polyethylenimine PEI MAX 40000 (Polysciences). For transfection, first 150 μL of Opti-MEM (Gibco) and 10 μL of PEI were mixed and incubated for 5 min, then 1 μg of substrate plasmid and 2 μg of gRNA plasmid were added to the mixture and incubated for another 15 min. The transfection mixture was then added to 90-100% confluent cells (in the 6-well format, which is equivalent to 1 x 106 cells). For 16HBE cells transfection, 2.5 μg of plasmid DNA was transfected using Lipofectamine LTX (Thermo Fisher Scientific) according to the manufacturer’s reverse transfection protocol. MEF-cDNA cells were transfected with 5 μg of plasmid DNA using Neon Transfection System (Thermo Fisher Scientific) (the parameters were set at 1,350 V, 30 ms, and 1 pulse).
RT-PCR assay
Total RNA was collected from 1 of 10-cm dishes or 1 of the 6 wells (6-well plate) with TRIzol reagent (Invitrogen) according to the manufacturer’s protocol.
Reverse transcription was performed using 200 ng of total RNA, a specific primer (specific to mRNA or gRNA; for gRNA, the primer named pugRev(X), where X is the target gene, was used), and SuperScriptIII reverse transcriptase according to the manufacture’s protocol. Annealing temperature was 55°C and extension temperature was 42°C. PCR was then performed using GoTaq Green Master Mix (Promega) and a specific pair of primers to measure the levels of various mRNAs and gRNAs. Primers used for PCR are: To detect β-globin mRNA, Fwd-pFlag2CMV2-HBB and GL-Ex2Ex3-Rev; to detect MUP loading control, MUP-S and MUP-AS; to detect β-actin loading control, ACTB-S and ACTB-AS; to detect CFTR mRNA, NBD1PSU-202Fwd and NBD1PSU+40; to detect IDUA mRNA, IDUA-65Fwd and IDUAPSU+157; to detect gRNA, pugFwd and pugRev(GL39) (or any other primers targeting the specific sequences of gRNA);. Quantification of the intensity of the PCR band was performed by Image Studio Lite (Licor).
Northern blot analysis
~25 μg of total RNA was resolved on 8 M urea-containing PAGE. The RNAs were transferred onto Amersham Hybond-N+ (Cytiva) in 0.5X TBE at 15 V overnight. The RNAs on the Hybond-N+ membrane were crosslinked by UV light (254 nm) (Stratalinker, 2500 μJ). The membrane was prehybridized with 100 μg/mL carrier RNA in hybridization buffer (250 mM Na-phosphate (pH 6.5), 5X SSC, 0.5% SDS) at 50°C for 2 hours followed by hybridization with the radiolabeled gRNA specific DNA oligo at 50°C for 8 hrs. The DNA oligos used for probing are pugRev(GL39) for gRNA and h/mU6-105 for U6 (Fig 1C). After washing the membrane with 1X SSC and 1% SDS 5 times, it was exposed to the phosphor screen and the radiation signals were visualized by autoradiography (Typhoon RGB, Cytiva).
Pseudouridylation assay (CMC-primer extension)
Primer-extension-based pseudouridylation assay was carried out as previously described71. Briefly, 20 μg of total RNA was treated with or without CMC at 37°C for 30 min. After being recovered by ethanol precipitation, the RNA was incubated with alkaline buffer at 37°C for 2 hours to remove CMC from U and G bases (but Ψ-CMC remains). RNA was then recovered and primer extension was performed, as previously described72. To detect β-thalassemia mRNA pseudouridylation (Fig 1F), the primer used here was a 5′ 32P-radiolabelled oligodeoxynucleotide complementary to nucleotides hGl193-209 (GL39+72). To detect human rRNA pseudouridylation (Fig S1), the primers were a 5′ 32P-radiolabelled oligodeoxynucleotide complementary to 28S rRNA nucleotides 3651-3673 (h28S-PSU3618+56) and a 5′ 32P-radiolabelled oligodeoxynucleotide complementary to nucleotides 4302-4322 of 28S rRNA (h28S-PSU4269+50). Signals corresponding to pseudouridines were visualized by autoradiography (Typhoon RGB, Cytiva).
Western blot assay
For HEK293T and MEF cells, total protein was collected by resuspending the cells with 500 μL of T-PER (Thermo Scientific) with complete Protease Inhibitor Cocktail (Roche) followed by removing cell debris by spinning down at 13,000 rpm for 10 min at 4°C. The cell lysate (total protein) was ready for immunoprecipitation and western blot analysis (see below). For 16HBE cells, total protein was collected by the protocol described in Valley et al51. Briefly, 300 μL of Pierce IP Complete lysis buffer was added to each well (6 well format), incubated on ice with occasional mixing for 15 min, and the cell lysate was collected with a cell scraper. Cell debris were removed by spinning down at 13,000 rpm for 20 min at 4°C, and the supernatant was used for western blot analysis.
To detect the full length of FLAG-tagged proteins (β-globin, FLAG-CFTR-NBD1, and FLAG-IDUA), the whole cell extract (total protein, described above) was applied to Pierce Anti-DYKDDDDK Magnetic Agarose (Thermo Fisher scientific) followed by immunoprecipitation according to the manufacture's protocol. Immunoprecipitated proteins were eluted by boiling at 95°C for 2 min with Laemmli SDS sample buffer. The eluted proteins were resolved by SDS-PAGE, which was followed by western blotting. To detect the full length CFTR protein derived from 16HBE cells, the cell lysate was mixed with 4X XT sample buffer and 20x XT reducing agent to the final concentration of 1X each. The mixture was incubated for 10 min at room temperature and then separated by SDS-PAGE. Specifically, mouse anti-DYKDDDDK Tag (9A3, Cell Signaling Technology), anti-beta-tubulin (9F3, Cell Signaling Technology), anti-hNBD1 (3G11, Scripps), anti-CFTR (M3A7, EMD Millipore), or anti-IDUA (ABIN6389869, antibodies-online Inc.) was used for the first antibody, followed by species-appropriate secondary antibody conjugated with HRP (7076 or 7074, Cell Signaling Technology). The chemiluminescent signals were developed by Radiance Plus Chemiliminescent (Azure Biosystems) with Azure c300 Gel Imaging System (Azure Biosystems). To detect CFTR full length protein from 16HBEge cells, the cell lysate (without prior IP) was directly used for western blotting51. The signal intensities of anti-FLAG, anti-IDUA, and anti-CFTR bands were normalized to the control anti-Tubulin band (as loading control) and then compared to the WT band. We performed two independent replicates and showed the representative blot images.
IDUA enzymatic assay
2 μL of the HEK293T lysate (out of 500 μL prepared from 1.2 x 106 cells and ten times dilution with T-PER buffer) or 25 μL of the MEF lysate (out of 500 μL prepared from 1.2 x 106 cells) was incubated with 25 μL of 360 μM 4-Methylumbelliferyl α-L-iduronide [in 0.4 M sodium formate buffer (pH 3.5 adjusted by formic acid and supplemented with final 4 mM of D-saccharic acid 1,4-lactone monohydrate)] as substrate in a total reaction volume of 250 μL (brought the volume up to 250 μL with T-PER buffer). The standard curve was made with 100, 50, 10, 5, and 2.5 pM of 4-methylbelliferone. After 2 hours of incubation, the fluorescence signal was measured using Spectramax M5 with excitation wavelength at 365 nm and emission at 450 nm.
Pseudo-seq library preparation
Transcriptome-wide detection of Ψs (Pseudo-seq) was performed according to the previously reported method77, except that the library preparation approach was adapted from 55. Briefly, poly-A tailed RNA (mRNA) was isolated from 100μg total RNA, and 2μg mRNA was then used for subsequent RNA shearing55 and CMC treatment (see above). Sheared RNA was then separated by size using 8% denaturing urea polyacrylamide gel, stained with SYBR Gold (Invitrogen), and visualized by Typhoon RGB. Gel slices with RNA fragments ranging from 80-140nt were excised, and the RNA was extracted and purified using acid phenol/chloroform followed by standard ethanol precipitation. RNA adaptor (RiL19) was then ligated to the 3' end of the purified RNA fragments using T4 RNA Ligase 1 (New England Biolabs), and the ligation products were purified with Dynabeads MyOne Silane (Invitrogen) and Buffer RLT (QIAGEN). Reverse transcription was then performed with Superscript III (Thermo Fisher Scientific) and the RT primer (AR17) to convert the RNA fragments to cDNA. DNA adaptor (rand103Tr3, with 10nt unique molecular identifier (UMI) denoted as NNNNNNNNNN) was then ligated to the 3' end of cDNA using T4 RNA Ligase 1. The ligation products were purified with Dynabeads MyOne Silane (Invitrogen) and Buffer PB (QIAGEN). Purified cDNA was then amplified with Q5 High-Fidelity DNA Polymerase and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, New England Biolabs). Libraries were further purified with Sera-Mag Select beads (cytiva) before submitted for next-generation sequencing.
Bioinformatics analysis
For data preprocessing, samples were submitted to the Genomics Research Center (GRC) at University of Rochester and sequenced by NextSeq 550 System with single-ended scheme and 150nt read length. Raw sequencing file was received from GRC and adapter sequences were removed using cutadapt73. 10nt unique molecular identifier (UMI) in 3’ adapter was extracted from read sequence using umi-tools74. After that, genome alignment was performed using STAR aligner75. 3’ end read coverage of mRNA for each sample was calculated using the alignment results using the genome coverage function of bedtools76 to output a bedgraph of 3’ end read density per nucleotide. In order to identify putative RT-stop sites, the genome-wide bedgraphs of 3’ end read density per nucleotide were filtered for a minimum read count of 10 to identify potential RT-stop sites (peaks). The bedgraphs were then assigned to genes using the intersectBed function of bedtools76. Using custom computational tools77, a genome-wide annotation of exon coordinates was developed from the splice-junction reads of the pseudoSeq data from all samples combined. Using the genomic coordinates of this de novo exon annotation, peaks were assigned to individual exons that are part of the consensus isoform of each gene. For each peak, a window of 30-100 nucleotides surrounding the peak position was determined based on the location of the peak within an exon, so as not to include intronic sequence, which is depleted of reads, in the window. The 3’ end read depth at each nucleotide of the window was determined using intersectBed with the previously created bedgraphs. The read depth at the peak position, and the distribution of per-nucleotide 3’ end read depth within the window were used in hypothesis testing algorithms described below.
To test each putative RT-stop site for significance, the list of 3’-end read counts within a fixed window (30-100 nucleotides depending on the genomic context, see above) were fitted with a Poisson distribution. The Poisson distribution variable mu was derived using maximum likelihood estimation. For peak calling, the read counts at each site to be tested were compared against the null hypothesis that the read count was sampled from the same Poisson distribution in order to derive p values. A Benjamini-Hochberg procedure was then used to control for false-discovery rate (FDR) at 0.05. Sites that were significant in the CMC+ sample but not in the CMC− sample and that have a genomic “T” base at the position downstream adjacent to the putative RT-stop site were labeled as high-confidence pseudouridylation sites.
Comparison of peak heights at putative pseudouridine sites were carried out as below. To identify potential off-target modifications in the presence of the gRNA treatment, the log2 fold-difference between peak height (RT-stop adjacent nucleotide 3’ end read counts) at all genomic ‘T’ positions and the median 3’ read count within the surrounding window was calculated for both the control and gRNA-treated samples. These values were plotted, and those peaks that reached statistical significance (FDR < 0.05) were colored orange to identify potential off-target sites. The correlation coefficient was computed by a linear regression model in R, and the R2 value determined.
To identify potential gRNA off-target sites, all putative RT-stops (“peaks”) at the nucleotide adjacent to and upstream of a genomic “T” from the direction of reverse transcription were filtered to identify any site that fit the core target sequence of the gRNA: ACCΨNGA, where the T is in the Ψ position and N is any nucleotide. The resulting peaks were further filtered to ensure matching of the target sequence in the transcript sense-direction. This resulted in 22 peaks. The match to the gRNA target sequence (TTGGACCΨNGAGGTTC) was then extended in both directions to determine the total number of contiguous matches. The sites were then categorized based on the p values for peak height over background of the surrounding window, to identify sites that were only significant in the gRNA-treated, CMC+ samples and none of the others, which would be expected of an off-target Ψ event.
QUANTIFICATION AND STATISTICAL ANALYSIS
All of the statistical details of experiments are shown in the figure legends. P values were calculated using unpaired Student’s t-tests. Error bars represent the mean ± S.D.
ADDITIONAL RESOURCES
Detailed protocol
A step-by-step protocol can be found in Methods S1.
Supplementary Material
KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-mouse IgG, HRP-linked | Cell Signaling Technology | #7076 |
| Anti-rabbit IgG, HRP-linked | Cell Signaling Technology | #7074 |
| Anti-rait IgG, HRP-linked | Cell Signaling Technology | #7077 |
| Anti-FLAG (DYKDDDDK Tag) (9A3) Mouse mAb | Cell Signaling Technology | #8146 |
| Anti-beta-Tubulin (9F3) Rabbit mAb | Cell Signaling Technology | #5346 |
| Rat anti-human NBD1 (3G11) | Scripps | N/A |
| Anti-CFTR Antibody, clone M3A7 | EMD Millipore | 05-583 |
| Anti-IDUA antibody (Iduronidase, alpha-L- (IDUA)) | antibodies-online Inc. | ABIN6389869 |
| Chemicals, peptides, and recombinant proteins | ||
| DMEM | GIBCO | 11965 |
| FBS | GIBCO | 26140-079 |
| Trypsin | GIBCO | 25300054 |
| Opti-MEM | GIBCO | 31985070 |
| Minimum Essential Medium | GIBCO | 11095-072 |
| Penicillin/Streptmycin | GIBCO | 15140-122 |
| LHC-8 basal medium | GIBCO | 12677 |
| Bovine serum albumin 7.5% | GIBCO | 15260-037 |
| Bovine collagen solution, Type 1 | Advanced BioMatrix | 5005-100ML |
| Fibronectin from human plasma, 1 mg/ml | Thermo Fisher Scientific | 33016-015 |
| PEI MAX 40000 | Polysciences | 49553-93-7 |
| TRIzol Reagent | Invitrogen | 15596018 |
| T-PER | Thermo Fisher Scientific | 78510 |
| IP lysis buffer | Thermo Fisher Scientific | 87787 |
| complete Protease Inhibitor Cocktail | Roche | 4693159001 |
| PfuUltra II Fusion High-Fidelity DNA polymerase | Agilent | 600385 |
| FastDigest SalI | Thermo Fisher Scientific | FD0644 |
| FastDigest PstI | Thermo Fisher Scientific | FD0614 |
| FastDigest HindIII | Thermo Fisher Scientific | FD0504 |
| FastDigest SacI | Thermo Fisher Scientific | FD1133 |
| FastDigest XbaI | Thermo Fisher Scientific | FD0684 |
| FastDigest BamHI | Thermo Fisher Scientific | FD0054 |
| T4 DNA ligase | Thermo Fisher Scientific | EL0016 |
| FastAP Alkaline Phosphatase | Thermo Fisher Scientific | EF0652 |
| GoTaq Green Master Mix | Promega | M712 |
| Q5 High-Fidelity 2X Master Mix | New England Biolabs | M0492L |
| SuperScript III | Thermo Fisher Scientific | 18080051 |
| CMC (1-Cyclohexyl-3-(2-morpholinoethyl)carbodiimide Metho-p-toluenesulfonate) | TCI | C0793 |
| Pierce Anti-DYKDDDDK Magnetic Agarose | Thermo Fisher Scientific | A36798 |
| 2X Laemmli SDS sample buffer | Bio-Rad | 1610737 |
| 4X XT sample buffer | BioRad | 161-0791 |
| 20x XT reducing agent | BioRad | 161-0792 |
| 4-Methylumbelliferyl α-L-iduronide (free acid) | Santa Cruz Biotechnology | 66966-09-4 |
| Sodium formate | Sigma-Aldrich | 25210 |
| formic acid | Sigma-Aid rich | 33015 |
| D-Saccharic acid 1,4-lactone monohydrate | Sigma-Aldrich | 49105 |
| 4-methylbelliferone | Sigma-Aldrich | M1381 |
| Oligo d(T)25 Magnetic Beads | New England Biolabs | S1419S |
| T4 RNA Ligase 1 (ssRNA Ligase) | New England Biolabs | M0437M |
| SYBR Select Master Mix | Applied Biosystems | 4472908 |
| Exonuclease I | Thermo Fisher Scientific | EN0581 |
| Sera-Mag Select | Cytiva | 29343045 |
| SYBR Gold Nucleic Acid Gel Stain | Invitrogen | S11494 |
| Dynabeads MyOne Silane | Invitrogen | 37002D |
| Buffer RLT | QIAGEN | 79216 |
| Buffer PB | QIAGEN | 19066 |
| Critical commercial assays | ||
| GeneJET Plasmid Midiprep Kit | Thermo Fisher Scientific | K0481 |
| NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) | New England Biolabs | E7335L |
| Lipofectamine LTX with Plus Reagent | Thermo Fisher Scientific | A12621 |
| Neon Transfection System | Invitrogen | MPK10025 |
| Deposited data | ||
| Raw and analyzed data | This paper | GEO: GSE221516 |
| Experimental models: Cell lines | ||
| HEK293T | ATCC | CRL-11268 |
| CFF-16HBE-G542X | Cystic Fibrosis Foundation | N/A |
| Mouse embryonic fibroblasts derived from homozygous C57BL/6 (with the mIDUA-W392X mutation) | ProQR therapeutics | N/A |
| Oligonucleotides | ||
| SDM-GL39-SWAPto-CFTR-G542X-1: TGGTGGACAATATAGTTCTTTGAGAAGGTGGAATCACATTTGGGGATCTGTCCACTCC | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto- CFTR-G542X-2: CCAAATGTGATTCCACCTTCTCAAAGAACTATATTGTCCACCAGCAGCCTAAGGGTGG | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-IDUA-W392X-1: TGGTGGATGGAGAACAACTCTAGGCAGAGGTCTCAAAGTTTGGGGATCTGTCCACTCC | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-IDUA-W392X-2: CCAAACTTTGAGACCTCTGCCTAGAGTTGTTCTCCATCCACCAGCAGCCTAAGGGTGG | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-P53R213X-1: CTGGTGGACAGAAACACTTTTTGACATAGTGTGGTGGTGTTTGGGGATCTGTCCACTCC | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-P53R213X-2: CCCAAACACCACCACACTATGTCAAAAAGTGTTTCTGTCCACCAGCAGCCTAAGGGTGG | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-CFTR-Y122X-1: TGGTGCGCTCTATCGCGATTTAACTAGGCATAGGCTTATTTGGGGATCTGTCCACTCC | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-CFTR-Y122X-2: CCAAATAAGCCTATGCCTAGTTAAATCGCGATAGAGCGCACCAGCAGCCTAAGGGTGG | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-CFTR-R1162X-1: TGGTGATGCGATCTGTGAGCTGAGTCTTTAAGTTCATTTTTGGGGATCTGTCCACTCC | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-CFTR-R1162X-2: CCAAAAATGAACTTAAAGACTCAGCTCACAGATCGCATCACCAGCAGCCTAAGGGTGG | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-CFTR-W1282X-1: TGGTGATAACTTTGCAACAGTGAAGGAAAGCCTTTGGATTTGGGGATCTGTCCACTCC | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-CFTR-W1282X-2: CCAAATCCAAAGGCTTTCCTTCACTGTTGCAAAGTTATCACCAGCAGCCTAAGGGTGG | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-NF1-R681X-1: TGGTGACCCCCCCGATTTGCTGACAAGCCCAGACCAAATTTGGGGATCTGTCCACTCC | Integrated DNA Technologies | N/A |
| SDM-GL39-SWAPto-NF1-R681X-2: CCAAATTTGGTCTGGGCTTGTCAGCAAATCGGGGGGGTCACCAGCAGCCTAAGGGTGG | Integrated DNA Technologies | N/A |
| pugU2-GL39terF1HindIII: ATTAAGCTTGTGTGGGAGATTACCTCTCGGACAGAGAGAAACTCTGCTGTGTCTGA | Integrated DNA Technologies | N/A |
| pugU2-GL39terR1: TTCGTCCCGGGAGGTTCAAGGCAGGGTCACTATAGGGAGATCGGACCTCAGACACAGCAG | Integrated DNA Technologies | N/A |
| pugU2-GL39terR2BamHI: ATGGATCCACCTGTCTGCCTCCTTGGACCCCGTTACGATTTCTCTCATTTCGTCCCGG | Integrated DNA Technologies | N/A |
| SDM1-GLintron1-Sal-Pst : GTAAGTCGACGAATTCTGCAGGCTGCTGGTGG | Integrated DNA Technologies | N/A |
| SDM2-GLintron1-Sal-Pst: GCCTGCAGAATTCGTCGACTTACCTGCCCAGG | Integrated DNA Technologies | N/A |
| pug-intron-R3: AATCTGCAGGGGAAAAGAGAGAGTCAGTACCTGTCTGCCTC | Integrated DNA Technologies | N/A |
| pugGL39ter-F1SalI: TAAGTCGACGTGGGAGATTACCTCTCGGACAGAGAGAAACTCTGCTGTGTCTGAGGTCCG | Integrated DNA Technologies | N/A |
| pugGL39ter-R1: CTCTCATTTCGTCCCGGGAGGTTCAAGGCAGGGTCACTATAGGGAGATCGGACCTCAGAC | Integrated DNA Technologies | N/A |
| pugGL39ter-R2: CCTGTCTGCCTCCTTGGACCCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| pugCFTR-G542X-F1SalI: TAAGTCGACGTGGGAGATTCTAGTTCGGACAGAGAGAAACTCTGCTGTGTCTGAAAGAAG | Integrated DNA Technologies | N/A |
| pugCFTR-G542X-R1: CTCTCATTTCGTCCCGGAGAAGGTAAGGCAGGGTCACTATAGGGAGATCTTCTTTCAGAC | Integrated DNA Technologies | N/A |
| pugCFTR-G542X-R2: CCTGTCTGCCTCGTTTTCTTCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| pugIDUA-W392X-F1SalI: TAAGTCGACGTGGGAGATTCTGCCTCGGACAGAGAGAAACTCTGCTGTGTCTGAGAGTTG | Integrated DNA Technologies | N/A |
| pugIDUA-W392X-R1: CTCTCATTTCGTCCCGGGGCAGAGAAGGCAGGGTCACTATAGGGAGATCAACTCTCAGAC | Integrated DNA Technologies | N/A |
| pugIDUA-W392X-R2: CCTGTCTGCCTCGTAAACTCCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| Pugp53-R213X-F1SalI: TAAGTCGACGTGGGAGATTCTAGTTCGGACAGAGAGAAACTCTGCTGTGTCTGAAAAAGG | Integrated DNA Technologies | N/A |
| pugp53-R213X-R1: CTCTCATTTCGTCCCGGACATAGTAAGGCAGGGTCACTATAGGGAGATCCTTTTTCAGAC | Integrated DNA Technologies | N/A |
| pugp53-R213X-R2: CCTGTCTGCCTCACACTTTTCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| pugCFTR-Y122X-F1SalI: TAAGTCGACGTGGGAGATTCTAGTTCGGACAGAGAGAAACTCTGCTGTGTCTGAAATCGG | Integrated DNA Technologies | N/A |
| pugCFTR-Y122X-R1: CTCTCATTTCGTCCCGGACTAGGCAAGGCAGGGTCACTATAGGGAGATCCGATTTCAGAC | Integrated DNA Technologies | N/A |
| pugCFTR-Y122X-R2: CCTGTCTGCCTCTCGCGATTCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| pugCFTR-R1162X-F1SalI: TAAGTCGACGTGGGAGATTAGACTTCGGACAGAGAGAAACTCTGCTGTGTCTGAGCTCAG | Integrated DNA Technologies | N/A |
| pugCFTR-R1162X-R1: CTCTCATTTCGTCCCGGAGTCTTTAAGGCAGGGTCACTATAGGGAGATCTGAGCTCAGAC | Integrated DNA Technologies | N/A |
| pugCFTR-R1162X-R2: CCTGTCTGCCTCCTGTGAGCCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| pugCFTR-W1282X-F1SalI: TAAGTCGACGTGGGAGATTTCCTTTCGGACAGAGAGAAACTCTGCTGTGTCTGACTGTTG | Integrated DNA Technologies | N/A |
| pugCFTR-W1282X-R1: CTCTCATTTCGTCCCGGAAGGAAAAAGGCAGGGTCACTATAGGGAGATCAACAGTCAGAC | Integrated DNA Technologies | N/A |
| pugCFTR-W1282X-R2: CCTGTCTGCCTCTGCAACAGCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| pugNF1-R681X-F1SalI: TAAGTCGACGTGGGAGATTCTTGTTCGGACAGAGAGAAACTCTGCTGTGTCTGAGCAAAG | Integrated DNA Technologies | N/A |
| pugNF1-R681X-R1: CTCTCATTTCGTCCCGGACAAGCCAAGGCAGGGTCACTATAGGGAGATCTTTGCTCAGAC | Integrated DNA Technologies | N/A |
| pugNF1-R681X-R2: CCTGTCTGCCTCCGATTTGCCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| F1pugCFTRstem: TAAGTCGACGTGGGAGATCCTTCTTCGGACAGAGAGAAACTCTGCTGTGTCCGAAAGAAG | Integrated DNA Technologies | N/A |
| R1pugCFTRstem: CTCTCATTTCGTCCCGGAGAAGGTAAGGCAGGGTCACTATAGGGAGATCTTCTTTCGGAC | Integrated DNA Technologies | N/A |
| R2pugCFTRstem: CCTGTCTGCCTCTAGTTCTTCCGGGACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| F1pugCFTR8: TAAGTCGACGTGGGAGATTGTTCTTCGGACAGAGAGAAACTCTGCTGTGTCTGAAAGATG | Integrated DNA Technologies | N/A |
| R1pugCFTR8: CTCTCATTTCGTCCCGGAGAACCAAAGGCAGGGTCACTATAGGGAGATCATCTTTCAGAC | Integrated DNA Technologies | N/A |
| R2pugCFTR8: CCTGTCTGCCTCATCATCTTCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| F1pugCFTR6: TAAGTCGACGTGGGAGATTGATCTTCGGACAGAGAGAAACTCTGCTGTGTCTGAAAGTTG | Integrated DNA Technologies | N/A |
| R1pugCFTR6: CTCTCATTTCGTCCCGGAGATCCAAAGGCAGGGTCACTATAGGGAGATCAACTTTCAGAC | Integrated DNA Technologies | N/A |
| R2pugCFTR6: CCTGTCTGCCTCATCAACTTCCGTTACGATTTCTCTCATTTCGTC | Integrated DNA Technologies | N/A |
| Fwd-pFlag2CMV2-HBB: ACGACGATGACAAGCATATG | Integrated DNA Technologies | N/A |
| GL-Ex2Ex3-Rev: TGCCCAGGAGCCTGA | Integrated DNA Technologies | N/A |
| MUP-S: CTGATGGGGCTCTATG | Integrated DNA Technologies | N/A |
| MUP-AS: TCCTGGTGAGAAGTCTCC | Integrated DNA Technologies | N/A |
| ACTB-S: AATCGTGCGTGACATTAAG | Integrated DNA Technologies | N/A |
| ACTB-AS: TTTCGTGGATGCCACAGG | Integrated DNA Technologies | N/A |
| pugFwd: GTCGACGTGGGAGAT | Integrated DNA Technologies | N/A |
| pugRev(GL39): TTTCGTCCCGGGAGGTTC | Integrated DNA Technologies | N/A |
| pugRev(CFTR-G542X): TTTCGTCCCGGAGAAGGT | Integrated DNA Technologies | N/A |
| pugRev(IDUA-W392X): TTTCGTCCCGGGGCAGAG | Integrated DNA Technologies | N/A |
| pugRev(p53-R213X): TTTCGTCCCGGACATAGT | Integrated DNA Technologies | N/A |
| pugRev(CFTR-Y122X): TTTCGTCCCGGACTAGGC | Integrated DNA Technologies | N/A |
| pugRev(CFTR-R1162X): TTTCGTCCCGGAGTCTTT | Integrated DNA Technologies | N/A |
| pugRev(CFTR-W1282X): TTTCGTCCCGGAAGGAAA | Integrated DNA Technologies | N/A |
| pugRev(NF1-R681X): TTTCGTCCCGGACAAGCC | Integrated DNA Technologies | N/A |
| NBD1PSU-202Fwd: CTGGAGCCTTCAGAGG | Integrated DNA Technologies | N/A |
| NBD1PSU+40: GCTCTTGCTAAAGAAATTC | Integrated DNA Technologies | N/A |
| IDUA-65Fwd: AGTTGCTGCGAAAGCCAGTA | Integrated DNA Technologies | N/A |
| IDUAPSU+157: ATACTGTGGTTGGGGTGTGC | Integrated DNA Technologies | N/A |
| h/mU6-105: AATATGGAACGCTTCACGAA | Integrated DNA Technologies | N/A |
| GL39+72: CCGAGCACTTTCTTGCC | Integrated DNA Technologies | N/A |
| h28S-PSU3618+56: AATCACATCGCGTCAACACCCGC | Integrated DNA Technologies | N/A |
| h28S-PSU4269+50: AAGGTCAGAAGGATCGTGAGG | Integrated DNA Technologies | N/A |
| AR17: ACACGACGCTCTTCCGA | Integrated DNA Technologies | N/A |
| RiL19: /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ | Integrated DNA Technologies | N/A |
| rand103Tr3: /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ | Integrated DNA Technologies | N/A |
| Recombinant DNA | ||
| pFLAG2CMV2-HBB | Kurosaki et al.38 | N/A |
| pdRLuc-Gl | Kurosaki et al.38 | N/A |
| YEplac195 | ATCC | 87589 |
| pFLAG2CMV2-HBB-CFTR-G542X | This paper | N/A |
| pFLAG2CMV2-HBB-IDUA-W392X | This paper | N/A |
| pFLAG2CMV2-HBB-p53-R213X | This paper | N/A |
| pFLAG2CMV2-HBB-CFTR-Y122X | This paper | N/A |
| pFLAG2CMV2-HBB-CFTR-R1162X | This paper | N/A |
| pFLAG2CMV2-HBB-CFTR-W1282X | This paper | N/A |
| pFLAG2CMV2-HBB-NF1-R681X | This paper | N/A |
| pdRLuc-Gl-Intronic-gRNA-GL39ter | This paper | N/A |
| pdRLuc-Gl-Intronic-gRNA-CFTR-G542X | This paper | N/A |
| pdRLuc-Gl-Intronic-gRNA-IDUA-W392X | This paper | N/A |
| pdRLuc-Gl-Intronic-gRNA-p53-R213X | This paper | N/A |
| pdRLuc-Gl-Intronic-gRNA-CFTR-Y122X | This paper | N/A |
| pdRLuc-Gl-Intronic-gRNA-CFTR-R1162X | This paper | N/A |
| pdRLuc-Gl-Intronic-gRNA-CFTR-W1282X | This paper | N/A |
| pdRLuc-Gl-Intronic-gRNA-NF1-R681X | This paper | N/A |
| pcDNA3.1Zeo(+)-gRNA-GL39ter | This paper | N/A |
| pcDNA3.1(+)_NBD1delRIdelRE_G542X | This paper | N/A |
| pCMV6_mmidua_W392X | This paper | N/A |
| pAAV- mCherry-HSPA5intron-pugCFTR | This paper | N/A |
| pAAV- mCherry-HSPA5intron-pugIDUA | This paper | N/A |
| Software and algorithms | ||
| Image Studio Lite ver 4.0 | Licor | https://www.licor.com/bio/image-studio-lite/ |
| GIMP (GNU Image Manipulation Program) ver 2.10 | Spencer Kimball and Peter Mattis | https://www.gimp.org |
| T100 Thermal Cycler | Bio-Rad | 1861096 |
| Amersham Typhoon RGB | Cytiva | GEH29187193EA |
| Azure Gel Imaging System | Azure Biosystems | c300 |
| Spectramax Microplate Reader | Molecular Devices | M5 |
| Other | ||
| Detailed step-by-step protocol | This study | Methods S1 |
Highlights.
PTC pseudouridylation directed by designer box H/ACA RNAs suppresses nonsense mutations
PTC pseudouridylation can concurrently suppress NMD and translation termination at PTCs
Coupling PTC pseudouridylation with antibiotic treatment enhances nonsense suppression
Designer box H/ACA RNAs show no significant off-target pseudouridylation activities
Acknowledgements
The original plasmids containing the β-thalassemia (Q39X) gene or the wild-type β-globin gene were gifts from the Lynne Maquat laboratory. We thank Cystic Fibrosis Foundation for sharing the CFF-16HBE-G542X cell line. We also thank Dr. David Bedwell and Dr. Kim Keeling for the mouse embryonic fibroblasts. This work was supported by Grants GM138387 (to Y-T.Y.) and CA241111 (to Y-T.Y.) from the NIH, Grant YU20G0 (to Y-T.Y. and P.M.) from the Cystic Fibrosis Foundation, and Grant GFF 521008 (to Y-T.Y. and P.M) from the Gilbert Family Foundation.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
DECLARATION OF INTERESTS
A patent relating to this work was filed and granted. Y.-T.Y. serves as a member of Scientific Advisory Board at ProQR Therapeutics.
References
- 1.Mort M, Ivanov D, Cooper DN, and Chuzhanova NA (2008). A meta-analysis of nonsense mutations causing human genetic disease. Hum. Mutat 29, 1037–1047. 10.1002/humu.20763. [DOI] [PubMed] [Google Scholar]
- 2.Peltz SW, Morsy M, Welch EM, and Jacobson A (2013). Ataluren as an agent for therapeutic nonsense suppression. Annu. Rev. Med 64, 407–425. 10.1146/annurev-med-120611-144851. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Karijolich J, and Yu Y-T (2014). Therapeutic suppression of premature termination codons: mechanisms and clinical considerations (review). Int. J. Mol. Med 34, 355–362. 10.3892/ijmm.2014.1809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Mendell JT, and Dietz HC (2001). When the message goes awry: disease-producing mutations that influence mRNA content and performance. Cell 107, 411–414. 10.1016/s0092-8674(01)00583-9. [DOI] [PubMed] [Google Scholar]
- 5.Atkinson J, and Martin R (1994). Mutations to nonsense codons in human genetic disease: implications for gene therapy by nonsense suppressor tRNAs. Nucleic Acids Res 22, 1327–1334. 10.1093/nar/22.8.1327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kurosaki T, Popp MW, and Maquat LE (2019). Quality and quantity control of gene expression by nonsense-mediated mRNA decay. Nat Rev Mol Cell Biol 20, 406–420. 10.1038/s41580-019-0126-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Brogna S, McLeod T, and Petrie M (2016). The Meaning of NMD: Translate or Perish. Trends Genet 32, 395–407. 10.1016/j.tig.2016.04.007. [DOI] [PubMed] [Google Scholar]
- 8.Martins-Dias P, and Romão L (2021). Nonsense suppression therapies in human genetic diseases. Cell Mol Life Sci 78, 4677–4701. 10.1007/s00018-021-03809-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Fanen P, Wohlhuter-Haddad A, and Hinzpeter A (2014). Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies. Int. J. Biochem. Cell Biol 52, 94–102. 10.1016/j.biocel.2014.02.023. [DOI] [PubMed] [Google Scholar]
- 10.Linde L, and Kerem B (2008). Introducing sense into nonsense in treatments of human genetic diseases. Trends Genet 24, 552–563. 10.1016/j.tig.2008.08.010. [DOI] [PubMed] [Google Scholar]
- 11.Thein SL (2013). The molecular basis of β-thalassemia. Cold Spring Harb Perspect Med 3, a011700. 10.1101/cshperspect.a011700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Scott HS, Bunge S, Gal A, Clarke LA, Morris CP, and Hopwood JJ (1995). Molecular genetics of mucopolysaccharidosis type I: diagnostic, clinical, and biological implications. Hum Mutat 6, 288–302. 10.1002/humu.1380060403. [DOI] [PubMed] [Google Scholar]
- 13.Li K, Turner AN, Chen M, Brosius SN, Schoeb TR, Messiaen LM, Bedwell DM, Zinn KR, Anastasaki C, Gutmann DH, et al. (2016). Mice with missense and nonsense NF1 mutations display divergent phenotypes compared with human neurofibromatosis type I. Dis Model Mech 9, 759–767. 10.1242/dmm.025783. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhang M, Heldin A, Palomar-Siles M, Öhlin S, Bykov VJN, and Wiman KG (2018). Synergistic Rescue of Nonsense Mutant Tumor Suppressor p53 by Combination Treatment with Aminoglycosides and Mdm2 Inhibitors. Frontiers in Oncology 7, 323. 10.3389/fonc.2017.00323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Bykov VJN, Eriksson SE, Bianchi J, and Wiman KG (2018). Targeting mutant p53 for efficient cancer therapy. Nat. Rev. Cancer 18, 89–102. 10.1038/nrc.2017.109. [DOI] [PubMed] [Google Scholar]
- 16.Morais P, Adachi H, and Yu Y-T (2020). Suppression of Nonsense Mutations by New Emerging Technologies. Int J Mol Sci 21. 10.3390/ijms21124394. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Karijolich J, and Yu Y-T (2011). Converting nonsense codons into sense codons by targeted pseudouridylation. Nature 474, 395–398. 10.1038/nature10165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Huang C, Wu G, and Yu Y-T (2012). Inducing nonsense suppression by targeted pseudouridylation. Nat Protoc 7, 789–800. 10.1038/nprot.2012.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Adachi H, and Yu Y-T (2020). Pseudouridine-mediated stop codon readthrough in S. cerevisiae is sequence context-independent. RNA 26, 1247–1256. 10.1261/rna.076042.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Fernández IS, Ng CL, Kelley AC, Wu G, Yu Y-T, and Ramakrishnan V (2013). Unusual base pairing during the decoding of a stop codon by the ribosome. Nature 500, 107–110. 10.1038/nature12302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Linde L, Boelz S, Nissim-Rafinia M, Oren YS, Wilschanski M, Yaacov Y, Virgilis D, Neu-Yilik G, Kulozik AE, Kerem E, et al. (2007). Nonsense-mediated mRNA decay affects nonsense transcript levels and governs response of cystic fibrosis patients to gentamicin. J Clin Invest 117, 683–692. 10.1172/JCI28523. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Porter JJ, Heil CS, and Lueck JD (2021). Therapeutic promise of engineered nonsense suppressor tRNAs. Wiley Interdiscip Rev RNA 12, e1641. 10.1002/wma.1641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.De Zoysa MD, Wu G, Katz R, and Yu Y-T (2018). Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation. RNA 24, 1106–1117. 10.1261/ma.066837.118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Xiao M, Yang C, Schattner P, and Yu Y-T (2009). Functionality and substrate specificity of human box H/ACA guide RNAs. RNA 15, 176–186. 10.1261/rna.1361509. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Carlile TM, Rojas-Duran MF, Zinshteyn B, Shin H, Bartoli KM, and Gilbert WV (2014). Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells. Nature 515, 143–146. 10.1038/nature13802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ganot P, Bortolin ML, and Kiss T (1997). Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89, 799–809. 10.1016/s0092-8674(00)80263-9. [DOI] [PubMed] [Google Scholar]
- 27.Li Y-H, Zhang G, and Cui Q (2015). PPUS: a web server to predict PUS-specific pseudouridine sites. Bioinformatics 31, 3362–3364. 10.1093/bioinformatics/btv366. [DOI] [PubMed] [Google Scholar]
- 28.Ni J, Tien AL, and Fournier MJ (1997). Small nucleolar RNAs direct site-specific synthesis of pseudouridine in ribosomal RNA. Cell 89, 565–573. [DOI] [PubMed] [Google Scholar]
- 29.Yu Y-T, and Meier UT (2014). RNA-guided isomerization of uridine to pseudouridine--pseudouridylation. RNA Biol 77, 1483–1494. 10.4161/15476286.2014.972855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Chen W, Tang H, Ye J, Lin H, and Chou K-C (2016). iRNA-PseU: Identifying RNA pseudouridine sites. Mol Ther Nucleic Acids 5, e332. 10.1038/mtna.2016.37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Aziz AZB, Hasan MAM, and Shin J (2021). Identification of RNA pseudouridine sites using deep learning approaches. PLoS One 16, e0247511. 10.1371/journal.pone.0247511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kiss T, Fayet E, Jady BE, Richard P, and Weber M (2006). Biogenesis and intranuclear trafficking of human box C/D and H/ACA RNPs. Cold Spring Harb Symp Quant Biol 71, 407–417. 10.1101/sqb.2006.71.025. [DOI] [PubMed] [Google Scholar]
- 33.Liu J, and Maxwell ES (1990). Mouse U14 snRNA is encoded in an intron of the mouse cognate hsc70 heat shock gene. Nucleic Acids Res 18, 6565–6571. 10.1093/nar/18.22.6565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Richard P, Kiss AM, Darzacq X, and Kiss T (2006). Cotranscriptional recognition of human intronic box H/ACA snoRNAs occurs in a splicing-independent manner. Mol Cell Biol 26, 2540–2549. 10.1128/MCB.26.7.2540-2549.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Tycowski KT, Shu MD, and Steitz JA (1996). A mammalian gene with introns instead of exons generating stable RNA products. Nature 379, 464–466. 10.1038/379464a0. [DOI] [PubMed] [Google Scholar]
- 36.Zhao X, Li Z-H, Terns RM, Terns MP, and Yu Y-T (2002). An H/ACA guide RNA directs U2 pseudouridylation at two different sites in the branchpoint recognition region in Xenopus oocytes. RNA 8, 1515–1525. [PMC free article] [PubMed] [Google Scholar]
- 37.Shatkin AJ (1976). Capping of eucaryotic mRNAs. Cell 9, 645–653. 10.1016/0092-8674(76)90128-8. [DOI] [PubMed] [Google Scholar]
- 38.Kurosaki T, and Maquat LE (2013). Rules that govern UPF1 binding to mRNA 3’ UTRs. Proc Natl Acad Sci U S A 110, 3357–3362. 10.1073/pnas.1219908110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Cao A, Gossens M, and Pirastu M (1989). Beta thalassaemia mutations in Mediterranean populations. Br J Haematol 71, 309–312. 10.1111/j.1365-2141.1989.tb04285.x. [DOI] [PubMed] [Google Scholar]
- 40.Kurosaki T, Imamachi N, Pröschel C, Mitsutomi S, Nagao R, Akimitsu N, and Maquat LE (2021). Loss of the fragile X syndrome protein FMRP results in misregulation of nonsense-mediated mRNA decay. Nat Cell Biol 23, 40–48. 10.1038/s41556-020-00618-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bakin A, and Ofengand J (1993). Four newly located pseudouridylate residues in Escherichia coli 23S ribosomal RNA are all at the peptidyltransferase center: analysis by the application of a new sequencing technique. Biochemistry 32, 9754–9762. 10.1021/bi00088a030. [DOI] [PubMed] [Google Scholar]
- 42.Keeling KM, and Bedwell DM (2011). Suppression of nonsense mutations as a therapeutic approach to treat genetic diseases. Wiley Interdiscip Rev RNA 2, 837–852. 10.1002/wrna.95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Kelly EK, Czekay DP, and Kothe U (2019). Base-pairing interactions between substrate RNA and H/ACA guide RNA modulate the kinetics of pseudouridylation, but not the affinity of substrate binding by H/ACA small nucleolar ribonucleoproteins. RNA 25, 1393–1404. 10.1261/rna.071043.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wangen JR, and Green R (2020). Stop codon context influences genome-wide stimulation of termination codon readthrough by aminoglycosides. eLife 9, e52611. 10.7554/eLife.52611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Heier CR, and DiDonato CJ (2009). Translational readthrough by the aminoglycoside geneticin (G418) modulates SMN stability in vitro and improves motor function in SMA mice in vivo. Hum Mol Genet 18, 1310–1322. 10.1093/hmg/ddp030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Zingman LV, Park S, Olson TM, Alekseev AE, and Terzic A (2007). Aminoglycoside-induced translational read-through in disease: overcoming nonsense mutations by pharmacogenetic therapy. Clin Pharmacol Ther 81, 99–103. 10.1038/sjclpt.6100012. [DOI] [PubMed] [Google Scholar]
- 47.Meier UT (2005). The many facets of H/ACA ribonucleoproteins. Chromosoma 114, 1–14. 10.1007/s00412-005-0333-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Wang C, and Meier UT (2004). Architecture and assembly of mammalian H/ACA small nucleolar and telomerase ribonucleoproteins. EMBO J 23, 1857–1867. 10.1038/sj.emboj.7600181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Maquat LE (2004). Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics. Nat Rev Mol Cell Biol 5, 89–99. 10.1038/nrm1310. [DOI] [PubMed] [Google Scholar]
- 50.Van Nostrand EL, Pratt GA, Shishkin AA, Gelboin-Burkhart C, Fang MY, Sundararaman B, Blue SM, Nguyen TB, Surka C, Elkins K, et al. (2016). Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nat Methods 13, 508–514. 10.1038/nmeth.3810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Valley HC, Bukis KM, Bell A, Cheng Y, Wong E, Jordan NJ, Allaire NE, Sivachenko A, Liang F, Bihler H, et al. (2019). Isogenic cell models of cystic fibrosis-causing variants in natively expressing pulmonary epithelial cells. Journal of Cystic Fibrosis 18, 476–483. 10.1016/j.jcf.2018.12.001. [DOI] [PubMed] [Google Scholar]
- 52.Hopwood JJ, Muller V, Smithson A, and Baggett N (1979). A fluorometric assay using 4-methylumbelliferyl alpha-L-iduronide for the estimation of alpha-L-iduronidase activity and the detection of Hurler and Scheie syndromes. Clin Chim Acta 92, 257–265. 10.1016/0009-8981(79)90121-9. [DOI] [PubMed] [Google Scholar]
- 53.Whitley CB, Gorlin RJ, and Krivit W (1987). A nonpathologic allele (IW) for low alpha-L-iduronidase enzyme activity vis-a-vis prenatal diagnosis of Hurler syndrome. Am J Med Genet 28, 233–243. 10.1002/ajmg.1320280136. [DOI] [PubMed] [Google Scholar]
- 54.Kiss T, Fayet-Lebaron E, and Jády BE (2010). Box H/ACA small ribonucleoproteins. Mol Cell 37, 597–606. 10.1016/j.molcel.2010.01.032. [DOI] [PubMed] [Google Scholar]
- 55.Wu G, Adachi H, Ge J, Stephenson D, Query CC, and Yu Y (2016). Pseudouridines in U2 snRNA stimulate the ATPase activity of Prp5 during spliceosome assembly. EMBO J 35, 654–667. 10.15252/embj.201593113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Chanfreau G, Legrain P, and Jacquier A (1998). Yeast RNase III as a key processing enzyme in small nucleolar RNAs metabolism. J Mol Biol 284, 975–988. 10.1006/jmbi.1998.2237. [DOI] [PubMed] [Google Scholar]
- 57.McCracken S, Fong N, Rosonina E, Yankulov K, Brothers G, Siderovski D, Hessel A, Foster S, Shuman S, and Bentley DL (1997). 5’-Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II. Genes Dev 11, 3306–3318. 10.1101/gad.11.24.3306. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Caton EA, Kelly EK, Kamalampeta R, and Kothe U (2018). Efficient RNA pseudouridylation by eukaryotic H/ACA ribonucleoproteins requires high affinity binding and correct positioning of guide RNA. Nucleic Acids Res 46, 905–916. 10.1093/nar/gkx1167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Kiss AM, Jady BE, Bertrand E, and Kiss T (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell. Biol 24, 5797–5807. 10.1128/MCB.24.13.5797-5807.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Eyler DE, Franco MK, Batool Z, Wu MZ, Dubuke ML, Dobosz-Bartoszek M, Jones JD, Polikanov YS, Roy B, and Koutmou KS (2019). Pseudouridinylation of mRNA coding sequences alters translation. PNAS 116, 23068–23074. 10.1073/pnas.1821754116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Xue X, Mutyam V, Thakerar A, Mobley J, Bridges RJ, Rowe SM, Keeling KM, and Bedwell DM (2017). Identification of the amino acids inserted during suppression of CFTR nonsense mutations and determination of their functional consequences. Hum Mol Genet 26, 3116–3129. 10.1093/hmg/ddx196. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Roy B, Friesen WJ, Tomizawa Y, Leszyk JD, Zhuo J, Johnson B, Dakka J, Trotta CR, Xue X, Mutyam V, et al. (2016). Ataluren stimulates ribosomal selection of near-cognate tRNAs to promote nonsense suppression. Proc. Natl. Acad. Sci. U.S.A 113, 12508–12513. 10.1073/pnas.1605336113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Ofengand J, and Fournier MJ (1998). The pseudouridine residues of rRNA: number, location, biosynthesis, and function. In Grosjean H, ed. Modification and Editing of RNA (ASM Press; ), pp. 229–253. [Google Scholar]
- 64.Chau VQ, Hu J, Gong X, Hulleman JD, Cifret-Vincenty RL, Rigo F, Prakash TP, Corey DR, and Mootha VV (2020). Delivery of Antisense Oligonucleotides to the Cornea. Nucleic Acid Ther 30, 207–214. 10.1089/nat.2019.0838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Ziccardi L, Cordeddu V, Gaddini L, Matteucci A, Parravano M, Malchiodi-Albedi F, and Varano M (2019). Gene Therapy in Retinal Dystrophies. Int J Mol Sci 20, 5722. 10.3390/ijms20225722. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Zhuge Y, Zhang J, Qian F, Wen Z, Niu C, Xu K, Ji H, Rong X, Chu M, and Jia C (2020). Role of smooth muscle cells in Cardiovascular Disease. Int J Biol Sci 16, 2741–2751. 10.7150/ijbs.49871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Dugger BN, and Dickson DW (2017). Pathology of Neurodegenerative Diseases. Cold Spring Harb Perspect Biol 9, a028035. 10.1101/cshperspect.a028035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Oussoren E, Keulemans J, van Diggelen OP, Oemardien LF, Timmermans RG, van der Ploeg AT, and Ruijter GJG (2013). Residual α-l-iduronidase activity in fibroblasts of mild to severe Mucopolysaccharidosis type I patients. Molecular Genetics and Metabolism 109, 377–381. 10.1016/j.ymgme.2013.05.016. [DOI] [PubMed] [Google Scholar]
- 69.Edgar R, Domrachev M, and Lash AE (2002). Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res 30, 207–210. 10.1093/nar/30.1.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Wang D, Shukla C, Liu X, Schoeb TR, Clarke LA, Bedwell DM, and Keeling KM (2010). Characterization of an MPS I-H knock-in mouse that carries a nonsense mutation analogous to the human IDUA-W402X mutation. Mol Genet Metab 99, 62–71. 10.1016/j.ymgme.2009.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Ma X, Zhao X, and Yu Y-T (2003). Pseudouridylation (Psi) of U2 snRNA in S. cerevisiae is catalyzed by an RNA-independent mechanism. EMBO J. 22, 1889–1897. 10.1093/emboj/cdg191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Yu YT, Shu MD, and Steitz JA (1998). Modifications of U2 snRNA are required for snRNP assembly and pre-mRNA splicing. EMBO J. 17, 5783–5795. 10.1093/emboj/17.19.5783. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Martin M (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17, 10–12. 10.14806/ej.17.1.200. [DOI] [Google Scholar]
- 74.Smith T, Heger A, and Sudbery I (2017). UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Res 27, 491–499. 10.1101/gr.209601.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, and Gingeras TR (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Quinlan AR, and Hall IM (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842. 10.1093/bioinformatics/btq033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Boutz PL, Bhutkar A, and Sharp PA (2015). Detained introns are a novel, widespread class of post-transcriptionally spliced introns. Genes Dev 29, 63–80. 10.1101/gad.247361.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Pseudo-seq data have been deposited in NCBI's Gene Expression Omnibus69 and are accessible through GEO Series accession number GSE221516 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE221516).
The software has been deposited into GitHub, and a Zenodo repository created. This DOI allows access to the software: DOI: 10.5281/zenodo.7460422.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.